Morpholino
MO1-tbx16
- ID
- ZDB-MRPHLNO-051107-1
- Name
- MO1-tbx16
- Previous Names
-
- spt MO #1 (1)
- Target
- Sequence
-
5' - AGCCTGCATTATTTAGCCTTCTCTA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tbx16
No data available
Phenotype
Phenotype resulting from MO1-tbx16
No data available
Phenotype of all Fish created by or utilizing MO1-tbx16
1 - 5 of 13 Show all
Citations
- Paulissen, E., Palmisano, N.J., Waxman, J., Martin, B.L. (2022) Somite morphogenesis is required for axial blood vessel formation during zebrafish embryogenesis. eLIFE. 11:
- Kinney, B.A., Al Anber, A., Row, R.H., Tseng, Y.J., Weidmann, M.D., Knaut, H., Martin, B.L. (2020) Sox2 and Canonical Wnt Signaling Interact to Activate a Developmental Checkpoint Coordinating Morphogenesis with Mesoderm Fate Acquisition. Cell Reports. 33:108311
- Manning, A.J., Kimelman, D. (2015) Tbx16 and Msgn1 are required to establish directional cell migration of zebrafish mesodermal progenitors. Developmental Biology. 406(2):172-85
- Araya, C., Tawk, M., Girdler, G.C., Costa, M., Carmona-Fontaine, C., and Clarke, J.D. (2014) Mesoderm is required for coordinated cell movements within zebrafish neural plate in vivo. Neural Development. 9(1):9
- Huang, C.J., Wilson, V., Pennings, S., MacRae, C.A., and Mullins, J. (2013) Sequential effects of spadetail, one-eyed pinhead and no tail on midline convergence of nephric primordia during zebrafish embryogenesis. Developmental Biology. 384(2):290-300
- Row, R.H., Maître, J.L., Martin, B.L., Stockinger, P., Heisenberg, C.P., and Kimelman, D. (2011) Completion of the epithelial to mesenchymal transition in zebrafish mesoderm requires Spadetail. Developmental Biology. 354(1):102-110
- Ren, X., Gomez, G.A., Zhang, B., and Lin, S. (2010) Scl isoforms act downstream of etsrp to specify angioblasts and definitive hematopoietic stem cells. Blood. 115(26):5338-5346
- Garnett, A.T., Han, T.M., Gilchrist, M.J., Smith, J.C., Eisen, M.B., Wardle, F.C., and Amacher, S.L. (2009) Identification of direct T-box target genes in the developing zebrafish mesoderm. Development (Cambridge, England). 136(5):749-760
- Gourronc, F., Ahmad, N., Nedza, N., Eggleston, T., and Rebagliati, M. (2007) Nodal activity around Kupffer's vesicle depends on the T-box transcription factors notail and spadetail and on notch signaling. Developmental Dynamics : an official publication of the American Association of Anatomists. 236(8):2131-2146
- Muyskens, J.B., and Kimmel, C.B. (2007) Tbx16 cooperates with Wnt11 in assembling the zebrafish organizer. Mechanisms of Development. 124(1):35-42
1 - 10 of 13
Show