Morpholino
MO1-gata6
- ID
- ZDB-MRPHLNO-050927-1
- Name
- MO1-gata6
- Previous Names
-
- zfMDL MO (1)
- Target
- Sequence
-
5' - AGCTGTTATCACCCAGGTCCATCCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The sequence reported in Peterkin et al, 2003 is written 3' -> 5'. The sequence shown has been reversed.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gata6
No data available
Phenotype
Phenotype resulting from MO1-gata6
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO1-gata6
1 - 5 of 38 Show all
Citations
- Song, M., Yuan, X., Racioppi, C., Leslie, M., Stutt, N., Aleksandrova, A., Christiaen, L., Wilson, M.D., Scott, I.C. (2022) GATA4/5/6 family transcription factors are conserved determinants of cardiac versus pharyngeal mesoderm fate. Science advances. 8:eabg0834
- Jia, W., Liang, D., Li, N., Liu, M., Dong, Z., Li, J., Dong, X., Yue, Y., Hu, P., Yao, J., Zhao, Q. (2018) Zebrafish microRNA miR-210-5p inhibits primitive myelopoiesis by silencing foxj1b and slc3a2a mRNAs downstream of gata4/5/6 transcription factor genes. The Journal of biological chemistry. 294(8):2732-2743
- Yuan, X., Song, M., Devine, P., Bruneau, B.G., Scott, I.C., Wilson, M.D. (2018) Heart enhancers with deeply conserved regulatory activity are established early in zebrafish development. Nature communications. 9:4977
- Miyagi, H., Nag, K., Sultana, N., Munakata, K., Hirose, S., Nakamura, N. (2016) Characterization of the zebrafish cx36.7 gene promoter: Its regulation of cardiac-specific expression and skeletal muscle-specific repression. Gene. 577(2):265-74
- Gupta, V., Gemberling, M., Karra, R., Rosenfeld, G.E., Evans, T., and Poss, K.D. (2013) An Injury-Responsive Gata4 Program Shapes the Zebrafish Cardiac Ventricle. Current biology : CB. 23(13):1221-7
- Novikov, N., and Evans, T. (2013) Tmem88a mediates GATA-dependent specification of cardiomyocyte progenitors by restricting WNT signaling. Development (Cambridge, England). 140(18):3787-98
- Liang, D., Jia, W., Li, J., Li, K., and Zhao, Q. (2012) Retinoic Acid signaling plays a restrictive role in zebrafish primitive myelopoiesis. PLoS One. 7(2):e30865
- Zeng, L., and Childs, S.J. (2012) The smooth muscle microRNA miR-145 regulates gut epithelial development via a paracrine mechanism. Developmental Biology. 367(2):178-186
- Tseng, W.F., Jang, T.H., Huang, C.B., and Yuh, C.H. (2011) An evolutionarily conserved kernel of gata5, gata6, otx2 and prdm1a operates in the formation of endoderm in zebrafish. Developmental Biology. 357(2):541-57
- Chan, T.M., Chao, C.H., Wang, H.D., Yu, Y.J., and Yuh, C.H. (2009) Functional analysis of the evolutionarily conserved Cis-regulatory elements on the Sox17 gene in zebrafish. Developmental Biology. 326(2):456-470
1 - 10 of 18
Show