Morpholino
MO1-scrib
- ID
- ZDB-MRPHLNO-050718-1
- Name
- MO1-scrib
- Previous Names
-
- MO/ATG (1)
- Target
- Sequence
-
5' - CCACAGCGGGATACACTTCAGCATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-scrib
No data available
Phenotype
Phenotype resulting from MO1-scrib
1 - 5 of 15 Show all
Phenotype of all Fish created by or utilizing MO1-scrib
1 - 5 of 21 Show all
Citations
- Wang, H., Zaiser, F., Eckert, P., Ruf, J., Kayser, N., Veenstra, A.C., Müller, M., Haas, R., Walz, G., Yakulov, T.A. (2023) Inversin (NPHP2) and Vangl2 are required for normal zebrafish cloaca formation. Biochemical and Biophysical Research Communications. 673:9159-15
- Xu, D., Lv, J., He, L., Fu, L., Hu, R., Cao, Y., Mei, C. (2018) Scribble influences cyst formation in autosomal-dominant polycystic kidney disease by regulating Hippo signaling pathway. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 32(8):4394-4407
- Young, T., Poobalan, Y., Tan, E.K., Tao, S., Ong, S., Wehner, P., Schwenty-Lara, J., Lim, C.Y., Sadasivam, A., Lovatt, M., Wang, S.T., Ali, Y., Borchers, A., Sampath, K., Dunn, N.R. (2014) The PDZ domain protein Mcc is a novel effector of non-canonical Wnt signaling during convergence and extension in zebrafish. Development (Cambridge, England). 141:3505-16
- Michaelis, U.R., Chavakis, E., Kruse, C., Jungblut, B., Kaluza, D., Wandzioch, K., Manavski, Y., Heide, H., Santoni, M.J., Potente, M., Eble, J.A., Borg, J.P., and Brandes, R.P. (2013) The Polarity Protein Scrib is Essential for Directed Endothelial Cell Migration. Circulation research. 112(6):924-934
- Burcklé, C., Gaudé, H.M., Vesque, C., Silbermann, F., Salomon, R., Jeanpierre, C., Antignac, C., Saunier, S., and Schneider-Maunoury, S. (2011) Control of the Wnt pathways by nephrocystin-4 is required for morphogenesis of the zebrafish pronephros. Human molecular genetics. 20(13):2611-27
- Walsh, G.S., Grant, P.K., Morgan, J.A., and Moens, C.B. (2011) Planar polarity pathway and Nance-Horan syndrome-like 1b have essential cell-autonomous functions in neuronal migration. Development (Cambridge, England). 138(14):3033-3042
- Zigman, M., Trinh, L.A., Fraser, S.E., and Moens, C.B. (2011) Zebrafish Neural Tube Morphogenesis Requires Scribble-Dependent Oriented Cell Divisions. Current biology : CB. 21(1):79-86
- Skouloudaki, K., Puetz, M., Simons, M., Courbard, J.R., Boehlke, C., Hartleben, B., Engel, C., Moeller, M.J., Englert, C., Bollig, F., Schäfer, T., Ramachandran, H., Mlodzik, M., Huber, T.B., Kuehn, E.W., Kim, E., Kramer-Zucker, A., and Walz, G. (2009) Scribble participates in Hippo signaling and is required for normal zebrafish pronephros development. Proceedings of the National Academy of Sciences of the United States of America. 106(21):8579-8584
- Vervenne, H.B., Crombez, K.R., Lambaerts, K., Carvalho, L., Koeppen, M., Heisenberg, C.P., Van de Ven, W.J., and Petit, M.M. (2008) Lpp is involved in Wnt/PCP signaling and acts together with Scrib to mediate convergence and extension movements during zebrafish gastrulation. Developmental Biology. 320(1):267-277
- Wada, H., Iwasaki, M., Sato, T., Masai, I., Nishiwaki, Y., Tanaka, H., Sato, A., Nojima, Y., and Okamoto, H. (2005) Dual roles of zygotic and maternal Scribble1 in neural migration and convergent extension movements in zebrafish embryos. Development (Cambridge, England). 132(10):2273-2285
1 - 10 of 10
Show