Morpholino
MO3-sox9b
- ID
- ZDB-MRPHLNO-050322-1
- Name
- MO3-sox9b
- Previous Names
-
- e2/i2-sox9b
- Target
- Sequence
-
5' - TGCAGTAATTTACCGGAGTGTTCTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-sox9b
No data available
Phenotype
Phenotype resulting from MO3-sox9b
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO3-sox9b
1 - 5 of 36 Show all
Citations
- Lan, Y., Pan, H., Li, C., Banks, K.M., Sam, J., Ding, B., Elemento, O., Goll, M.G., Evans, T. (2019) TETs Regulate Proepicardial Cell Migration through Extracellular Matrix Organization during Zebrafish Cardiogenesis. Cell Reports. 26:720-732.e4
- Garcia, G.R., Shankar, P., Dunham, C.L., Garcia, A., La Du, J.K., Truong, L., Tilton, S.C., Tanguay, R.L. (2018) Signaling Events Downstream of AHR Activation That Contribute to Toxic Responses: The Functional Role of an AHR-Dependent Long Noncoding RNA ( slincR) Using the Zebrafish Model. Environmental health perspectives. 126:117002
- Chen, J.W., Galloway, J.L. (2014) The development of zebrafish tendon and ligament progenitors. Development (Cambridge, England). 141:2035-45
- Hofsteen, P., Plavicki, J., Johnson, S.D., Peterson, R.E., and Heideman, W. (2013) Sox9b is Required for Epicardium Formation and Plays a Role in TCDD-induced Heart Malformation in Zebrafish. Molecular pharmacology. 84(3):353-60
- Xiong, K.M., Peterson, R.E., and Heideman, W. (2008) Aryl hydrocarbon receptor-mediated down-regulation of sox9b causes jaw malformation in zebrafish embryos. Molecular pharmacology. 74(6):1544-1553
- Yan, Y.L., Willoughby, J., Liu, D., Crump, J.G., Wilson, C., Miller, C.T., Singer, A., Kimmel, C., Westerfield, M., and Postlethwait, J.H. (2005) A pair of Sox: distinct and overlapping functions of zebrafish sox9 co-orthologs in craniofacial and pectoral fin development. Development (Cambridge, England). 132(5):1069-1083
1 - 6 of 6
Show