Morpholino
MO1-wnt4
- ID
- ZDB-MRPHLNO-050318-1
- Name
- MO1-wnt4
- Previous Names
-
- MO1-wnt4a
- wnt4-MO (1)
- Target
- Sequence
-
5' - CTCCGATGACATCTTTAGTGGAATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a translation blocking morpholino targeting the translation initiation site of wnt4a.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wnt4
No data available
Phenotype
Phenotype resulting from MO1-wnt4
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-wnt4
1 - 5 of 32 Show all
Citations
- Gordon, L.R., Gribble, K.D., Syrett, C.M., and Granato, M. (2012) Initiation of synapse formation by Wnt-induced MuSK endocytosis. Development (Cambridge, England). 139(5):1023-1033
- Wan, X., Ji, W., Mei, X., Zhou, J., Liu, J.X., Fang, C., and Xiao, W. (2010) Negative Feedback Regulation of Wnt4 Signaling by EAF1 and EAF2/U19. PLoS One. 5(2):e9118
- Hendricks, M., Mathuru, A.S., Wang, H., Silander, O., Kee, M.Z., and Jesuthasan, S. (2008) Disruption of Esrom and Ryk identifies the roof plate boundary as an intermediate target for commissure formation. Molecular and cellular neurosciences. 37(2):271-283
- Ciruna, B., Jenny, A., Lee, D., Mlodzik, M., and Schier, A.F. (2006) Planar cell polarity signalling couples cell division and morphogenesis during neurulation. Nature. 439(7073):220-224
- Matsui, T., Raya, A., Kawakami, Y., Callol-Massot, C., Capdevila, J., Rodriguez-Esteban, C., Izpisúa Belmonte, J.C. (2005) Noncanonical Wnt signaling regulates midline convergence of organ primordia during zebrafish development. Genes & Development. 19(1):164-175
1 - 5 of 5
Show