Morpholino
MO5-neurog1
- ID
- ZDB-MRPHLNO-050308-15
- Name
- MO5-neurog1
- Previous Names
- None
- Target
- Sequence
-
5' - ATACGATCTCCATTGTTGATAACCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-neurog1
No data available
Phenotype
Phenotype resulting from MO5-neurog1
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO5-neurog1
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| neurogenesis process quality, abnormal | WT + MO5-neurog1 | standard conditions |
Fig. 1
from Sobieszczuk et al., 2010 |
| primary neuron decreased amount, abnormal | WT + MO5-neurog1 | standard conditions |
Fig. 1
from Sobieszczuk et al., 2010 |
1 - 2 of 2
Citations
- Gerety, S.S., and Wilkinson, D.G. (2011) Morpholino artifacts provide pitfalls and reveal a novel role for pro-apoptotic genes in hindbrain boundary development. Developmental Biology. 350(2):279-289
- Sobieszczuk, D.F., Poliakov, A., Xu, Q., and Wilkinson, D.G. (2010) A feedback loop mediated by degradation of an inhibitor is required to initiate neuronal differentiation. Genes & Development. 24(2):206-218
- Nikolaou, N., Watanabe-Asaka, T., Gerety, S., Distel, M., Köster, R.W., and Wilkinson, D.G. (2009) Lunatic fringe promotes the lateral inhibition of neurogenesis. Development (Cambridge, England). 136(15):2523-2533
- Amoyel, M., Cheng, Y.C., Jiang, Y.J., and Wilkinson, D.G. (2005) Wnt1 regulates neurogenesis and mediates lateral inhibition of boundary cell specification in the zebrafish hindbrain. Development (Cambridge, England). 132(4):775-785
1 - 4 of 4
Show