Morpholino
MO1-ascl1b
- ID
- ZDB-MRPHLNO-050308-14
- Name
- MO1-ascl1b
- Previous Names
-
- ashb MO (1)
- Target
- Sequence
-
5' - TCGTAGCGACGACAGTTGCCTCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ascl1b
No data available
Phenotype
Phenotype resulting from MO1-ascl1b
Phenotype of all Fish created by or utilizing MO1-ascl1b
1 - 5 of 9 Show all
Citations
- Di Bella, D.J., Carcagno, A.L., Bartolomeu, M.L., Pardi, M.B., Löhr, H., Siegel, N., Hammerschmidt, M., Marín-Burgin, A., Lanuza, G.M. (2019) Ascl1 Balances Neuronal versus Ependymal Fate in the Spinal Cord Central Canal. Cell Reports. 28:2264-2274.e3
- Flasse, L.C., Pirson, J.L., Stern, D.G., Von Berg, V., Manfroid, I., Peers, B., and Voz, M.L. (2013) Ascl1b and Neurod1, instead of Neurog3, control pancreatic endocrine cell fate in zebrafish. BMC Biology. 11(1):78
- Yang, N., Dong, Z., and Guo, S. (2012) Fezf2 Regulates Multilineage Neuronal Differentiation through Activating Basic Helix-Loop-Helix and Homeodomain Genes in the Zebrafish Ventral Forebrain. The Journal of neuroscience : the official journal of the Society for Neuroscience. 32(32):10940-10948
- Gerety, S.S., and Wilkinson, D.G. (2011) Morpholino artifacts provide pitfalls and reveal a novel role for pro-apoptotic genes in hindbrain boundary development. Developmental Biology. 350(2):279-289
- Nikolaou, N., Watanabe-Asaka, T., Gerety, S., Distel, M., Köster, R.W., and Wilkinson, D.G. (2009) Lunatic fringe promotes the lateral inhibition of neurogenesis. Development (Cambridge, England). 136(15):2523-2533
- Amoyel, M., Cheng, Y.C., Jiang, Y.J., and Wilkinson, D.G. (2005) Wnt1 regulates neurogenesis and mediates lateral inhibition of boundary cell specification in the zebrafish hindbrain. Development (Cambridge, England). 132(4):775-785
- Stalmans, I., Lambrechts, D., De Smet, F., Jansen, S., Wang, J., Maity, S., Kneer, P., von der Ohe, M., Swillen, A., Maes, C., Gewillig, M., Molin, D.G., Hellings, P., Boetel, T., Haardt, M., Compernolle, V., Derwerchin, M., Plaisance, S., Vlietinck, R., Emanuel, B., Gittenberger-de Groot, A.C., Scambler, P., Morrow, B., Driscol, D.A., Moons, L., Esguerra, C.V., Carmeliet, G., Behn-Krappa, A., Devriendt, K., Collen, D., Conway, S.J., and Carmeliet, P. (2003) VEGF: a modifier of the del22q11 (DiGeorge) syndrome?. Nature medicine. 9(2):173-182
1 - 7 of 7
Show