Morpholino
MO1-tcf7l1b
- ID
- ZDB-MRPHLNO-050308-11
- Name
- MO1-tcf7l1b
- Previous Names
-
- MO2-tcf7l1b
- tcf3b-MO (1)
- Target
- Sequence
-
5' - CGCCTCCGTTAAGCTGCGGCATGTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a translation blocking morpholino
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tcf7l1b
No data available
Phenotype
Phenotype resulting from MO1-tcf7l1b
1 - 5 of 24 Show all
Phenotype of all Fish created by or utilizing MO1-tcf7l1b
1 - 5 of 44 Show all
Citations
- Mandal, A., Holowiecki, A., Song, Y.C., Waxman, J.S. (2017) Wnt signaling balances specification of the cardiac and pharyngeal muscle fields. Mechanisms of Development. 143:32-41
- Lu, F.I., Sun, Y.H., Wei, C.Y., Thisse, C., Thisse, B. (2014) Tissue-specific derepression of TCF/LEF controls the activity of the Wnt/β-catenin pathway. Nature communications. 5:5368
- Sorrell, M.R., Dohn, T.E., D'Aniello, E., and Waxman, J.S. (2013) Tcf7l1 proteins cell autonomously restrict cardiomyocyte and promote endothelial specification in zebrafish. Developmental Biology. 380(2):199-210
- Gerety, S.S., and Wilkinson, D.G. (2011) Morpholino artifacts provide pitfalls and reveal a novel role for pro-apoptotic genes in hindbrain boundary development. Developmental Biology. 350(2):279-289
- Ro, H., and Dawid, I.B. (2011) Modulation of Tcf3 repressor complex composition regulates cdx4 expression in zebrafish. The EMBO journal. 30(14):2894-907
- Gribble, S.L., Kim, H.S., Bonner, J., Wang, X., and Dorsky, R.I. (2009) Tcf3 inhibits spinal cord neurogenesis by regulating sox4a expression. Development (Cambridge, England). 136(5):781-789
- Caneparo, L., Huang, Y.L., Staudt, N., Tada, M., Ahrendt, R., Kazanskaya, O., Niehrs, C., and Houart, C. (2007) Dickkopf-1 regulates gastrulation movements by coordinated modulation of Wnt/betacatenin and Wnt/PCP activities, through interaction with the Dally-like homolog Knypek. Genes & Development. 21(4):465-480
- Nyholm, M.K., Wu, S.F., Dorsky, R.I., and Grinblat, Y. (2007) The zebrafish zic2a-zic5 gene pair acts downstream of canonical Wnt signaling to control cell proliferation in the developing tectum. Development (Cambridge, England). 134(4):735-746
- Amoyel, M., Cheng, Y.C., Jiang, Y.J., and Wilkinson, D.G. (2005) Wnt1 regulates neurogenesis and mediates lateral inhibition of boundary cell specification in the zebrafish hindbrain. Development (Cambridge, England). 132(4):775-785
- Riley, B.B., Chiang, M.Y., Storch, E.M., Heck, R., Buckles, G.R., and Lekven, A.C. (2004) Rhombomere boundaries are Wnt signaling centers that regulate metameric patterning in the zebrafish hindbrain. Developmental Dynamics : an official publication of the American Association of Anatomists. 231(2):278-291
1 - 10 of 12
Show