Morpholino
MO2-ascl1a
- ID
- ZDB-MRPHLNO-050301-4
- Name
- MO2-ascl1a
- Previous Names
-
- ash1a5'UTR MO (1)
- Target
- Sequence
-
5' - AAGGAGTGAGTCAAAGCACTAAAGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ascl1a
No data available
Phenotype
Phenotype resulting from MO2-ascl1a
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO2-ascl1a
1 - 4 of 4
Citations
- Kent, M.R., Kara, N., Patton, J.G. (2021) Inhibition of GABAA-ρ receptors induces retina regeneration in zebrafish. Neural regeneration research. 16:367-374
- Didiano, D., Abner, J.J., Hinger, S.A., Flickinger, Z., Kent, M., Clement, M.A., Balaiya, S., Liu, Q., Dai, X., Levine, E.M., Patton, J.G. (2020) Induction of a proliferative response in the zebrafish retina by injection of extracellular vesicles. Experimental Eye Research. 200:108254
- Mitra, S., Sharma, P., Kaur, S., Khursheed, M.A., Gupta, S., Chaudhary, M., Kurup, A.J., Ramachandran, R. (2019) Dual regulation of lin28a by Myc is necessary during zebrafish retina regeneration. The Journal of cell biology. 218(2):489-507
- Mitra, S., Sharma, P., Kaur, S., Khursheed, M.A., Gupta, S., Ahuja, R., Kurup, A.J., Chaudhary, M., Ramachandran, R. (2018) Histone Deacetylase-Mediated Müller Glia Reprogramming through Her4.1-Lin28a Axis Is Essential for Retina Regeneration in Zebrafish. iScience. 7:68-84
- Rao, M.B., Didiano, D., Patton, J.G. (2017) Neurotransmitter-Regulated Regeneration in the Zebrafish Retina. Stem Cell Reports. 8(4):831-842
- Williams, R.R., Venkatesh, I., Pearse, D.D., Udvadia, A.J., Bunge, M.B. (2015) MASH1/Ascl1a Leads to GAP43 Expression and Axon Regeneration in the Adult CNS. PLoS One. 10:e0118918
- MacDonald, R.B., Pollack, J.N., Debiais-Thibaud, M., Heude, E., Talbot, J.C., and Ekker, M. (2013) The ascl1a and dlx genes have a regulatory role in the development of GABAergic interneurons in the zebrafish diencephalon. Developmental Biology. 381(1):276-85
- Nelson, C.M., Ackerman, K.M., O'Hayer, P., Bailey, T.J., Gorsuch, R.A., and Hyde, D.R. (2013) Tumor Necrosis Factor-Alpha Is Produced by Dying Retinal Neurons and Is Required for Muller Glia Proliferation during Zebrafish Retinal Regeneration. The Journal of neuroscience : the official journal of the Society for Neuroscience. 33(15):6524-6539
- Powell, C., Elsaeidi, F., and Goldman, D. (2012) Injury-Dependent Muller Glia and Ganglion Cell Reprogramming during Tissue Regeneration Requires Apobec2a and Apobec2b. The Journal of neuroscience : the official journal of the Society for Neuroscience. 32(3):1096-1109
- Ramachandran, R., Zhao, X.F., and Goldman, D. (2012) Insm1a-mediated gene repression is essential for the formation and differentiation of Müller glia-derived progenitors in the injured retina. Nature cell biology. 14(10):1013-1023
1 - 10 of 15
Show