Morpholino

MO1-chrd

ID
ZDB-MRPHLNO-050221-6
Name
MO1-chrd
Previous Names
  • Chd(UTR) (1)
  • MO1-chd
  • zCdh (1)
  • chordin-MO (1)
Target
Sequence
5' - ATCCACAGCAGCCCCTCCATCATCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Effects are abnormal u-shaped somites, reduced head, extremely expanded blood island, and abnormal tail fin.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-chrd
No data available
Phenotype
Phenotype resulting from MO1-chrd
Phenotype Fish Figures
blood island size, abnormal WT + MO1-chrd Fig. 5 with image from Griepenburg et al., 2015
brain anterior region decreased size, abnormal TL + MO1-chrd Fig. 2 from Kamachi et al., 2008
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-chrd Fig. 5 with image from Aamar et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO1-chrd Fig. 4 with image from Aamar et al., 2010
determination of left/right symmetry disrupted, abnormal WT + MO1-chrd Fig. 6 with image from Aamar et al., 2010
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd Fig. 7 with imageFig. 8 with image from Branam et al., 2010
Fig. 8 with image from Dal-Pra et al., 2006
forerunner cell group decreased size, abnormal WT + MO1-chrd Fig. 7 with image from Aamar et al., 2010
head decreased size, abnormal WT + MO1-chrd Fig. 7 with image from Dixon Fox et al., 2009
Fig. 8 with image from Dal-Pra et al., 2006
heart looping disrupted, abnormal WT + MO1-chrd Fig. S4 with image from Aamar et al., 2010
intermediate cell mass of mesoderm increased size, abnormal TL + MO1-chrd Fig. 2 from Kamachi et al., 2008
Kupffer's vesicle bilateral, abnormal WT + MO1-chrd Fig. 6 with image from Aamar et al., 2010
Kupffer's vesicle decreased size, abnormal WT + MO1-chrd Fig. 6 with image from Aamar et al., 2010
Kupffer's vesicle inverted, abnormal WT + MO1-chrd Fig. 6 with image from Aamar et al., 2010
median fin fold increased amount, abnormal WT + MO1-chrd Fig. 5 with image from Xie et al., 2011
neural plate decreased length, abnormal WT + MO1-chrd Fig. 4 with image from Dal-Pra et al., 2006
neural plate decreased thickness, abnormal WT + MO1-chrd Fig. 4 with image from Dal-Pra et al., 2006
notochord decreased width, abnormal AB + MO1-chrd Fig. 7 with image from Dixon Fox et al., 2009
notochord truncated, abnormal AB + MO1-chrd Fig. 7 with image from Dixon Fox et al., 2009
otic vesicle decreased size, abnormal WT + MO1-chrd Fig. 4 with image from Dal-Pra et al., 2006
pancreatic B cell increased amount, abnormal AB + MO1-chrd Fig. 2 from Song et al., 2007
post-vent region apoptotic, abnormal WT + MO1-chrd Fig. 5 with image from Robu et al., 2007
post-vent region bent, abnormal WT + MO1-chrd + MO4-tp53 Fig. 8 with image from Branam et al., 2010
post-vent region increased size, abnormal WT + MO1-chrd Fig. 5 with image from Xie et al., 2011
Fig. 2 from Kamachi et al., 2008
post-vent region wholly ventralized, abnormal WT + MO1-chrd Fig. 2 with image from Esterberg et al., 2009
primitive heart tube bilateral, abnormal WT + MO1-chrd Fig. 5 with image from Aamar et al., 2010
primitive heart tube inverted, abnormal WT + MO1-chrd Fig. 5 with image from Aamar et al., 2010
somite U-shaped, abnormal WT + MO1-chrd Fig. 5 with image from Griepenburg et al., 2015
Fig. 5 with image from Xie et al., 2011
whole organism ventralized, abnormal AB + MO1-chrd Figure 4 with image from Cheng et al., 2019
Fig 6 with image from Ye et al., 2019
whole organism wholly ventralized, abnormal WT + MO1-chrd Fig. S6 with image from Moreno-Ayala et al., 2015
Fig. 4 with image from Kapp et al., 2013
Fig. 3 with image from Chen et al., 2012
Fig. 8 from Zhong et al., 2011
Fig. 7 with imageFig. 8 with image from Branam et al., 2010
Fig. 3 with imageFig. 4 with image from Zhang et al., 2010
Fig. 7 with image from Dixon Fox et al., 2009
Fig. 3 with imageFig. 7 with imageFig. 8 with image from Dal-Pra et al., 2006
whole organism ventral region szl expression increased distribution, abnormal AB + MO1-chrd Fig 6 with image from Ye et al., 2019
whole organism ventral region ved expression increased distribution, abnormal AB + MO1-chrd Fig 6 with image from Ye et al., 2019
Phenotype of all Fish created by or utilizing MO1-chrd
Phenotype Fish Conditions Figures
notochord truncated, abnormal AB + MO1-chrd standard conditions Fig. 7 with image from Dixon Fox et al., 2009
whole organism ventral region ved expression increased distribution, abnormal AB + MO1-chrd standard conditions Fig 6 with image from Ye et al., 2019
whole organism wholly ventralized, abnormal AB + MO1-chrd standard conditions Fig. 7 with image from Dixon Fox et al., 2009
pancreatic B cell increased amount, abnormal AB + MO1-chrd standard conditions Fig. 2 from Song et al., 2007
notochord decreased width, abnormal AB + MO1-chrd standard conditions Fig. 7 with image from Dixon Fox et al., 2009
whole organism ventral region szl expression increased distribution, abnormal AB + MO1-chrd standard conditions Fig 6 with image from Ye et al., 2019
whole organism ventralized, abnormal AB + MO1-chrd standard conditions Fig 6 with image from Ye et al., 2019
head decreased size, abnormal AB + MO1-chrd standard conditions Fig. 7 with image from Dixon Fox et al., 2009
intermediate cell mass of mesoderm increased size, abnormal TL + MO1-chrd standard conditions Fig. 2 from Kamachi et al., 2008
post-vent region increased size, abnormal TL + MO1-chrd standard conditions Fig. 2 from Kamachi et al., 2008
brain anterior region decreased size, abnormal TL + MO1-chrd standard conditions Fig. 2 from Kamachi et al., 2008
post-vent region increased size, abnormal TL + MO1-chrd + MO2-chrd standard conditions Fig. 2 from Kamachi et al., 2008
brain anterior region decreased size, abnormal TL + MO1-chrd + MO2-chrd standard conditions Fig. 2 from Kamachi et al., 2008
intermediate cell mass of mesoderm increased size, abnormal TL + MO1-chrd + MO2-chrd standard conditions Fig. 2 from Kamachi et al., 2008
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd standard conditions Fig. 7 with image from Branam et al., 2010
Fig. 8 with image from Dal-Pra et al., 2006
primitive heart tube inverted, abnormal WT + MO1-chrd standard conditions Fig. 5 with image from Aamar et al., 2010
Kupffer's vesicle inverted, abnormal WT + MO1-chrd standard conditions Fig. 6 with image from Aamar et al., 2010
determination of left/right symmetry disrupted, abnormal WT + MO1-chrd standard conditions Fig. 6 with image from Aamar et al., 2010
Kupffer's vesicle bilateral, abnormal WT + MO1-chrd standard conditions Fig. 6 with image from Aamar et al., 2010
post-vent region increased size, abnormal WT + MO1-chrd standard conditions Fig. 5 with image from Xie et al., 2011
somite U-shaped, abnormal WT + MO1-chrd standard conditions Fig. 5 with image from Griepenburg et al., 2015
Fig. 5 with image from Xie et al., 2011
neural plate decreased length, abnormal WT + MO1-chrd standard conditions Fig. 4 with image from Dal-Pra et al., 2006
median fin fold increased amount, abnormal WT + MO1-chrd standard conditions Fig. 5 with image from Xie et al., 2011
Kupffer's vesicle decreased size, abnormal WT + MO1-chrd standard conditions Fig. 6 with image from Aamar et al., 2010
post-vent region apoptotic, abnormal WT + MO1-chrd standard conditions Fig. 5 with image from Robu et al., 2007
primitive heart tube bilateral, abnormal WT + MO1-chrd standard conditions Fig. 5 with image from Aamar et al., 2010
whole organism ventralized, abnormal WT + MO1-chrd control Figure 4 with image from Cheng et al., 2019
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-chrd standard conditions Fig. 5 with image from Aamar et al., 2010
forerunner cell group decreased size, abnormal WT + MO1-chrd standard conditions Fig. 7 with image from Aamar et al., 2010
heart looping disrupted, abnormal WT + MO1-chrd standard conditions Fig. S4 with image from Aamar et al., 2010
blood island size, abnormal WT + MO1-chrd standard conditions Fig. 5 with image from Griepenburg et al., 2015
whole organism wholly ventralized, abnormal WT + MO1-chrd standard conditions Fig. 4 with image from Kapp et al., 2013
Fig. 8 from Zhong et al., 2011
Fig. 7 with image from Branam et al., 2010
Fig. 3 with imageFig. 4 with image from Zhang et al., 2010
Fig. 3 with imageFig. 7 with imageFig. 8 with image from Dal-Pra et al., 2006
post-vent region wholly ventralized, abnormal WT + MO1-chrd standard conditions Fig. 2 with image from Esterberg et al., 2009
neural plate decreased thickness, abnormal WT + MO1-chrd standard conditions Fig. 4 with image from Dal-Pra et al., 2006
head decreased size, abnormal WT + MO1-chrd standard conditions Fig. 8 with image from Dal-Pra et al., 2006
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO1-chrd standard conditions Fig. 4 with image from Aamar et al., 2010
otic vesicle decreased size, abnormal WT + MO1-chrd standard conditions Fig. 4 with image from Dal-Pra et al., 2006
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd + MO4-tp53 standard conditions Fig. 8 with image from Branam et al., 2010
post-vent region bent, abnormal WT + MO1-chrd + MO4-tp53 standard conditions Fig. 8 with image from Branam et al., 2010
post-vent region apoptotic, abnormal WT + MO1-chrd + MO4-tp53 standard conditions Fig. 5 with image from Robu et al., 2007
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO4-tp53 standard conditions Fig. S6 with image from Moreno-Ayala et al., 2015
Fig. 8 with image from Branam et al., 2010
whole organism wholly ventralized, abnormal t32231Tg + MO1-chrd standard conditions Fig. 3 with image from Chen et al., 2012
pancreatic B cell decreased amount, abnormal hnf1bahi2169Tg/hi2169Tg + MO1-chrd standard conditions Fig. 2 from Song et al., 2007
whole organism ventralized, exacerbated marcksbihb199/ihb199 + MO1-chrd standard conditions Fig 6 with image from Ye et al., 2019
whole organism ventral region ved expression increased distribution, abnormal marcksbihb199/ihb199 + MO1-chrd standard conditions Fig 6 with image from Ye et al., 2019
whole organism ventral region szl expression increased distribution, abnormal marcksbihb199/ihb199 + MO1-chrd standard conditions Fig 6 with image from Ye et al., 2019
notochord decreased width, abnormal AB + MO1-chrd + MO1-gsc standard conditions Fig. 7 with image from Dixon Fox et al., 2009
head decreased size, abnormal AB + MO1-chrd + MO1-gsc standard conditions Fig. 7 with image from Dixon Fox et al., 2009
notochord truncated, abnormal AB + MO1-chrd + MO1-gsc standard conditions Fig. 7 with image from Dixon Fox et al., 2009
whole organism wholly ventralized, abnormal AB + MO1-chrd + MO1-gsc standard conditions Fig. 7 with image from Dixon Fox et al., 2009
dorsal convergence disrupted, abnormal WT + MO1-cdh2 + MO1-chrd standard conditions Fig. 6 with image from von der Hardt et al., 2007
lateral mesoderm mislocalised, abnormal WT + MO1-cdh2 + MO1-chrd standard conditions Fig. 6 with image from von der Hardt et al., 2007
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd + MO1-fstl1b standard conditions Fig. 8 with image from Dal-Pra et al., 2006
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO1-fstl1b standard conditions Fig. 8 with image from Dal-Pra et al., 2006
head decreased size, abnormal WT + MO1-chrd + MO1-fstl1b standard conditions Fig. 8 with image from Dal-Pra et al., 2006
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 8 with image from Dal-Pra et al., 2006
head anterior region agenesis, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 3 with image from Dal-Pra et al., 2006
head decreased size, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 8 with image from Dal-Pra et al., 2006
neural plate decreased length, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 4 with image from Dal-Pra et al., 2006
head anterior region truncated, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 3 with image from Dal-Pra et al., 2006
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 3 with image from Zhang et al., 2010
Fig. 3 with imageFig. 7 with imageFig. 8 with image from Dal-Pra et al., 2006
neural plate decreased thickness, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 4 with image from Dal-Pra et al., 2006
otic vesicle mislocalised medially, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 4 with image from Dal-Pra et al., 2006
otic vesicle decreased size, abnormal WT + MO1-chrd + MO1-nog1 standard conditions Fig. 4 with image from Dal-Pra et al., 2006
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO1-zmiz2 + MO4-tp53 standard conditions Fig. S6 with image from Moreno-Ayala et al., 2015
post-vent region increased thickness, abnormal WT + MO1-chrd + MO2-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
blood circulation disrupted, abnormal WT + MO1-chrd + MO2-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO2-chrdl2 standard conditions Fig. 7 with imageFig. 8 with image from Branam et al., 2010
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd + MO2-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
head morphology, abnormal WT + MO1-chrd + MO2-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
head decreased size, abnormal WT + MO1-chrd + MO2-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd + MO2-chrdl2 + MO4-tp53 standard conditions Fig. 8 with image from Branam et al., 2010
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO2-chrdl2 + MO4-tp53 standard conditions Fig. 8 with image from Branam et al., 2010
head decreased size, abnormal WT + MO1-chrd + MO2-igfbp3 standard conditions Fig. 8 from Zhong et al., 2011
hematopoietic system increased size, abnormal WT + MO1-chrd + MO2-igfbp3 standard conditions Fig. 8 from Zhong et al., 2011
post-vent region increased size, abnormal WT + MO1-chrd + MO2-igfbp3 standard conditions Fig. 8 from Zhong et al., 2011
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO2-igfbp3 standard conditions Fig. 8 from Zhong et al., 2011
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO2-nog1 standard conditions text only from Dal-Pra et al., 2006
Kupffer's vesicle bilateral, abnormal WT + MO1-chrd + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
Kupffer's vesicle decreased size, abnormal WT + MO1-chrd + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
determination of left/right symmetry disrupted, abnormal WT + MO1-chrd + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
Kupffer's vesicle inverted, abnormal WT + MO1-chrd + MO2-sox17 standard conditions Fig. 6 with image from Aamar et al., 2010
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO3-bmper standard conditions Fig. 3 with image from Zhang et al., 2010
head decreased size, abnormal WT + MO1-chrd + MO3-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
post-vent region increased thickness, abnormal WT + MO1-chrd + MO3-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
head morphology, abnormal WT + MO1-chrd + MO3-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
blood circulation disrupted, abnormal WT + MO1-chrd + MO3-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO3-chrdl2 standard conditions Fig. 7 with image from Branam et al., 2010
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO3-wnt8a + MO5-wnt8a standard conditions Fig. 4 with image from Kapp et al., 2013
otic vesicle formation process quality, abnormal WT + MO1-chrd + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic placode formation process quality, abnormal WT + MO1-chrd + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic vesicle decreased size, abnormal WT + MO1-chrd + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic vesicle formation process quality, abnormal fgf8ati282a/ti282a + MO1-chrd + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic placode formation process quality, abnormal fgf8ati282a/ti282a + MO1-chrd + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
whole organism cytolysis increased occurrence, abnormal TL + MO1-chrd + MO1-fstl1b + MO1-nog1 standard conditions Fig. 4 with image from Langdon et al., 2016
whole organism wholly ventralized, abnormal TL + MO1-chrd + MO1-fstl1b + MO1-nog1 standard conditions Fig. 4 with image from Langdon et al., 2016
whole organism wholly dorsalized, abnormal WT + MO1-bmp1a + MO1-chrd + MO1-tll1 standard conditions Fig. 4 with image from Zhang et al., 2010
whole organism wholly ventralized, abnormal WT + MO1-chrd + MO1-fstl1b + MO1-nog1 standard conditions Fig. 2 with image from Kapp et al., 2013
Fig. 8 with image from Dal-Pra et al., 2006
dorsal/ventral pattern formation disrupted, abnormal WT + MO1-chrd + MO1-fstl1b + MO1-nog1 standard conditions Fig. 8 with image from Dal-Pra et al., 2006
head decreased size, abnormal WT + MO1-chrd + MO1-fstl1b + MO1-nog1 standard conditions Fig. 8 with image from Dal-Pra et al., 2006
trigeminal placode decreased size, abnormal WT + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 3 with image from Kwon et al., 2009
otic placode formation process quality, abnormal WT + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic vesicle decreased size, abnormal WT + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic vesicle malformed, abnormal WT + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic vesicle formation process quality, abnormal WT + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
inner ear lacks all parts of type otolith, abnormal WT + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
post-vent region wholly ventralized, abnormal WT + MO1-chrd + MO5-dlx3b + MO5-dlx4b standard conditions Fig. 2 with image from Esterberg et al., 2009
intermediate cell mass of mesoderm increased size, abnormal WT + MO1-chrd + MO5-dlx3b + MO5-dlx4b standard conditions Fig. 2 with image from Esterberg et al., 2009
whole organism cytolysis increased occurrence, abnormal ctsbap24bdth/+ + MO1-chrd + MO1-fstl1b + MO1-nog1 (TL) standard conditions Fig. 4 with image from Langdon et al., 2016
whole organism wholly dorsalized, ameliorated ctsbap24bdth/+ + MO1-chrd + MO1-fstl1b + MO1-nog1 (TL) standard conditions Fig. 4 with image from Langdon et al., 2016
whole organism wholly ventralized, abnormal ctsbap24bdth/+ + MO1-chrd + MO1-fstl1b + MO1-nog1 (TL) standard conditions Fig. 4 with image from Langdon et al., 2016
otic vesicle formation process quality, abnormal fgf8ati282a/ti282a + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic placode formation process quality, abnormal fgf8ati282a/ti282a + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
otic vesicle aplastic, abnormal fgf8ati282a/ti282a + MO1-chrd + MO2-bmper + MO6-fsta standard conditions Fig. 2 with image from Kwon et al., 2009
whole organism wholly ventralized, abnormal Df(Chr25:szl)m60/m60 + MO1-chrd (HK) standard conditions Fig. 1 with image from Dal-Pra et al., 2006
whole organism wholly ventralized, abnormal ints6p18ahub + MO1-chrd (AB/TU) standard conditions Fig. 4 with image from Kapp et al., 2013
whole organism wholly dorsalized, abnormal ints6p18ahub + MO1-chrd + MO3-wnt8a + MO5-wnt8a (AB/TU) standard conditions Fig. 4 with image from Kapp et al., 2013
whole organism wholly ventralized, abnormal ints6p18ahub + MO1-chrd + MO1-fstl1b + MO1-nog1 (AB/TU) standard conditions Fig. 2 with image from Kapp et al., 2013
whole organism wholly ventralized, abnormal brsb2; ctnnb2p1/p1 + MO1-chrd standard conditions Fig. 3 with image from Varga et al., 2007
post-vent region morphology, abnormal brsb2; ctnnb2p1/p1 + MO1-chrd standard conditions Fig. 3 with image from Varga et al., 2007
dorsal/ventral axis specification decreased process quality, ameliorated pou5f3m793/+; sox19bm1434/+ + MO1-chrd standard conditions Fig. 2 with image from Gao et al., 2022
whole organism wholly ventralized, abnormal brsb2; ctnnb2p1/p1 + MO1-chrd + MO1-ctnnb2 + MO2-ctnnb1 standard conditions Fig. 3 with image from Varga et al., 2007
post-vent region morphology, abnormal brsb2; ctnnb2p1/p1 + MO1-chrd + MO1-ctnnb2 + MO2-ctnnb1 standard conditions Fig. 3 with image from Varga et al., 2007
dorsal/ventral axis specification decreased process quality, ameliorated pou5f3m793/+; sox19bm1434/+ + MO1-chrd + MO1-nog1 standard conditions Fig. 2 with image from Gao et al., 2022
Citations