Morpholino
MO1-chrd
- ID
- ZDB-MRPHLNO-050221-6
- Name
- MO1-chrd
- Previous Names
- Target
- Sequence
-
5' - ATCCACAGCAGCCCCTCCATCATCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Effects are abnormal u-shaped somites, reduced head, extremely expanded blood island, and abnormal tail fin.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-chrd
No data available
Phenotype
Phenotype resulting from MO1-chrd
1 - 5 of 31 Show all
Phenotype of all Fish created by or utilizing MO1-chrd
1 - 5 of 124 Show all
Citations
- Sadamitsu, K., Velilla, F., Shinya, M., Kashima, M., Imai, Y., Kawasaki, T., Watai, K., Hosaka, M., Hirata, H., Sakai, N. (2024) Establishment of a zebrafish inbred strain, M-AB, capable of regular breeding and genetic manipulation. Scientific Reports. 14:74557455
- Gao, M., Veil, M., Rosenblatt, M., Riesle, A.J., Gebhard, A., Hass, H., Buryanova, L., Yampolsky, L.Y., Grüning, B., Ulianov, S.V., Timmer, J., Onichtchouk, D. (2022) Pluripotency factors determine gene expression repertoire at zygotic genome activation. Nature communications. 13:788
- Tajer, B., Dutko, J.A., Little, S.C., Mullins, M.C. (2021) BMP heterodimers signal via distinct type I receptor class functions. Proceedings of the National Academy of Sciences of the United States of America. 118(15):
- Cheng, V., Dasgupta, S., Reddam, A., Volz, D.C. (2019) Ciglitazone-a human PPARγ agonist-disrupts dorsoventral patterning in zebrafish. PeerJ. 7:e8054
- Yan, Y., Ning, G., Li, L., Liu, J., Yang, S., Cao, Y., Wang, Q. (2019) The BMP ligand Pinhead together with Admp supports the robustness of embryonic patterning. Science advances. 5:eaau6455
- Ye, D., Wang, X., Wei, C., He, M., Wang, H., Wang, Y., Zhu, Z., Sun, Y. (2019) Marcksb plays a key role in the secretory pathway of zebrafish Bmp2b. PLoS Genetics. 15:e1008306
- Bertotto, L.B., Dasgupta, S., Vliet, S., Dudley, S., Gan, J., Volz, D.C., Schlenk, D. (2018) Evaluation of the estrogen receptor alpha as a possible target of bifenthrin effects in the estrogenic and dopaminergic signaling pathways in zebrafish embryos. The Science of the total environment. 651:2424-2431
- Dasgupta, S., Vliet, S.M., Kupsco, A., Leet, J.K., Altomare, D., Volz, D.C. (2017) Tris(1,3-dichloro-2-propyl) phosphate disrupts dorsoventral patterning in zebrafish embryos. PeerJ. 5:e4156
- Tanaka, S., Hosokawa, H., Weinberg, E.S., Maegawa, S. (2017) Chordin and dickkopf-1b are essential for the formation of head structures through activation of the FGF signaling pathway in zebrafish. Developmental Biology. 424(2):189-197
- Zinski, J., Bu, Y., Wang, X., Dou, W., Umulis, D., Mullins, M. (2017) Systems biology derived source-sink mechanism of BMP gradient formation. eLIFE. 6
1 - 10 of 56
Show