Morpholino
MO6-pax8
- ID
- ZDB-MRPHLNO-050208-1
- Name
- MO6-pax8
- Previous Names
-
- variant 1 MO (1)
- Target
- Sequence
-
5' - GTTCACAAACATGCCTCCTAGTTGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
translation blocker for splice variant 1 (variant 1 MO). This MO blocks translation of variant 1 isoforms, which lack the N-terminal Paired domain.
Reference: Mackereth et al. (2005) - Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-pax8
No data available
Phenotype
Phenotype resulting from MO6-pax8
Phenotype | Fish | Figures |
---|---|---|
otic vesicle decreased size, abnormal | WT + MO6-pax8 |
Fig. 3 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO6-pax8
1 - 5 of 34 Show all
Citations
- Porreca, I., De Felice, E., Fagman, H., Di Lauro, R., and Sordino, P. (2012) Zebrafish bcl2l is a survival factor in thyroid development. Developmental Biology. 366(2):142-152
- Bhat, N., and Riley, B.B. (2011) Integrin-α5 Coordinates Assembly of Posterior Cranial Placodes in Zebrafish and Enhances Fgf-Dependent Regulation of Otic/Epibranchial Cells. PLoS One. 6(12):e27778
- Padanad, M.S., and Riley, B.B. (2011) Pax2/8 proteins coordinate sequential induction of otic and epibranchial placodes through differential regulation of foxi1, sox3 and fgf24. Developmental Biology. 351(1):90-98
- Sweet, E.M., Vemaraju, S., and Riley, B.B. (2011) Sox2 and Fgf interact with Atoh1 to promote sensory competence throughout the zebrafish inner ear. Developmental Biology. 358(1):113-21
- Millimaki, B.B., Sweet, E.M., Dhason, M.S., and Riley, B.B. (2007) Zebrafish atoh1 genes: classic proneural activity in the inner ear and regulation by Fgf and Notch. Development (Cambridge, England). 134(2):295-305
- Bricaud, O., and Collazo, A. (2006) The transcription factor six1 inhibits neuronal and promotes hair cell fate in the developing zebrafish (Danio rerio) inner ear. The Journal of neuroscience : the official journal of the Society for Neuroscience. 26(41):10438-10451
- Mackereth, M.D., Kwak, S.J., Fritz, A., and Riley, B.B. (2005) Zebrafish pax8 is required for otic placode induction and plays a redundant role with Pax2 genes in the maintenance of the otic placode. Development (Cambridge, England). 132(2):371-382
1 - 7 of 7
Show