Morpholino
MO1-tal1
- ID
- ZDB-MRPHLNO-050207-1
- Name
- MO1-tal1
- Previous Names
-
- MO8-tal1
- SCL E1/I
- scl E1/IMO (1)
- tal1 MO E1/I
- Target
- Sequence
-
5' - GCGGCGTTACCTGTTAATAGTGGCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets exon/intron boundary sequence of exon 1.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tal1
No data available
Phenotype
Phenotype resulting from MO1-tal1
No data available
Phenotype of all Fish created by or utilizing MO1-tal1
No data available
Citations
- Chou, C.W., Hsu, H.C., You, M.S., Lin, J., Liu, Y.W. (2016) The endoderm indirectly influences morphogenetic movements of the zebrafish head kidney through the posterior cardinal vein and VegfC. Scientific Reports. 6:30677
- Ma, A.C., Chung, M.I., Liang, R., and Leung, A.Y. (2010) A DEAB-sensitive aldehyde dehydrogenase regulates hematopoietic stem and progenitor cells development during primitive hematopoiesis in zebrafish embryos. Leukemia. 24(12):2090-2099
- Ellett, F., Kile, B.T., and Lieschke, G.J. (2009) The role of the ETS factor erg in zebrafish vasculogenesis. Mechanisms of Development. 126(3-4):220-229
- Galloway, J.L., Wingert, R.A., Thisse, C., Thisse, B., and Zon, L.I. (2008) Combinatorial regulation of novel erythroid gene expression in zebrafish. Experimental hematology. 36(4):424-432
- Liu, Y.W., and Guo, L. (2006) Endothelium is required for the promotion of interrenal morphogenetic movement during early zebrafish development. Developmental Biology. 297(1):44-58
- Dooley, K.A., Davidson, A.J., and Zon, L.I. (2005) Zebrafish scl functions independently in hematopoietic and endothelial development. Developmental Biology. 277(2):522-536
- Lin, H.F., Traver, D., Zhu, H., Dooley, K., Paw, B.H., Zon, L.I., and Handin, R.I. (2005) Analysis of thrombocyte development in CD41-GFP transgenic zebrafish. Blood. 106(12):3803-3810
- Weber, G.J., Choe, S.E., Dooley, K.A., Paffett-Lugassy, N.N., Zhou, Y., and Zon, L.I. (2005) Mutant-specific gene programs in the zebrafish. Blood. 106(2):521-530
1 - 8 of 8
Show