Morpholino
MO1-pax6b
- ID
- ZDB-MRPHLNO-041116-2
- Name
- MO1-pax6b
- Previous Names
-
- mo-1-pax6b (1)
- Target
- Sequence
-
5' - CTGAGCCCTTCCGAGCAAAACAGTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pax6b
No data available
Phenotype
Phenotype resulting from MO1-pax6b
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO1-pax6b
1 - 5 of 8 Show all
Citations
- Chatterjee, M., Guo, Q., Weber, S., Scholpp, S., and Li, J.Y. (2014) Pax6 regulates the formation of the habenular nuclei by controlling the temporospatial expression of Shh in the diencephalon in vertebrates. BMC Biology. 12(1):13
- Thummel, R., Enright, J.M., Kassen, S.C., Montgomery, J.E., Bailey, T.J., and Hyde, D.R. (2010) Pax6a and Pax6b are required at different points in neuronal progenitor cell proliferation during zebrafish photoreceptor regeneration. Experimental Eye Research. 90(5):572-582
- Nolte, C., Rastegar, M., Amores, A., Bouchard, M., Grote, D., Maas, R., Kovacs, E.N., Postlethwait, J., Rambaldi, I., Rowan, S., Yan, Y.L., Zhang, F., and Featherstone, M. (2006) Stereospecificity and PAX6 function direct Hoxd4 neural enhancer activity along the antero-posterior axis. Developmental Biology. 299(2):582-593
- Blader, P., Lam, C.S., Rastegar, S., Scardigli, R., Nicod, J.C., Simplicio, N., Plessy, C., Fischer, N., Schuurmans, C., Guillemot, F., and Strähle, U. (2004) Conserved and acquired features of neurogenin1 regulation. Development (Cambridge, England). 131(22):5627-5637
1 - 4 of 4
Show