IMAGE

Figure 2 supplement 3—source data 1.

ID
ZDB-IMAGE-191230-1800
Publication
Gancz et al., 2019 - Distinct origins and molecular mechanisms contribute to lymphatic formation during cardiac growth and regeneration
All Figures
Figures for Gancz et al., 2019
Image
Figure Caption

Figure 2 supplement 3—source data 1. Generation of zebrafish <italic>vegfd<sup>bns257</sup></italic> mutant allele.

(a) gRNA was designed to target sequences within exon 2 (E2) of the Vegfd protein. The gRNA target site is highlighted in yellow, and the PAM site in purple. Red letters shown in the vegfd allele indicate the CRISPR-induced fifty-nine nucleotide insertion. (b) Schematic diagram of wt and predicted vegfd protein products composed of 272 amino acids (aa) and 55 aa, respectively. SP: signal peptide, VHD: Vegf homology domain. (c) Sequence alignment of part of vegfd exon two from the vegfd+/+ and vegfd -/- allele shows the CRISPR-induced indels leading to the substitution of TAC (tyrosine residue at position 56) for TGA (stop codon) as indicated by red lines. A fifty-nine nucleotide insertion (GATGTTGACATTGGACATTGGATTTTGGTTGCCATACCTGATAAATAAATCTGATGTTG) in vegfd-/- was confirmed by the sequence chromatograms of the PCR products generated using vegfd+/+ and vegfd -/- adult fish genomic DNA as templates (n = 3 for vegfd+/+, n = 8 for vegfd -/-). (d–g) Confocal images showing the facial region of two independent 154 hpf vegfd+/+ (d,e) and vegfd -/- (f,g) larvae carrying the lyve1b reporter. Arrows in each panel point to the vessel terminals of the lateral facial lymphatics (LFL), medial facial lymphatics (MFL), and otolithic lymphatic vessel (OLV). (h) Quantification of average vessel lengths of LFL, MFL, and OLV of 154 hpf vegfd+/+ (n = 8) and vegfd -/- (n = 12) larvae demonstrate significant reduction in average vessel lengths of LFL and MFL. Scale bars are 100 µm.

Quantification of facial lymphatics development in <italic>vegfd <sup>-/-</sup></italic> embryos.

Acknowledgments
This image is the copyrighted work of the attributed author or publisher, and ZFIN has permission only to display this image to its users. Additional permissions should be obtained from the applicable author or publisher of the image. Full text @ Elife