CRISPR

CRISPR1-gon4la

ID
ZDB-CRISPR-260728-2
Name
CRISPR1-gon4la
Previous Names
None
Target
Sequence
5' - TTAGGAGGTCAAGACGACGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
nn2112 gon4la
Expression
Gene expression in Wild Types + CRISPR1-gon4la
No data available
Phenotype
Phenotype resulting from CRISPR1-gon4la
No data available
Phenotype of all Fish created by or utilizing CRISPR1-gon4la
Phenotype Fish Conditions Figures
pancreatic acinar cell zymogen granule exocytosis decreased occurrence, abnormal gon4lann2112/nn2112 standard conditions Fig. 5 with image from Tsai et al., 2026
gut pcna expression increased amount, abnormal gon4lann2112/nn2112 standard conditions Fig. 4 with image from Tsai et al., 2026
whole organism gon4la expression decreased amount, abnormal gon4lann2112/nn2112 standard conditions Fig. 1 with image from Tsai et al., 2026
intestine proliferative region increased size, abnormal gon4lann2112/nn2112 standard conditions Fig. 4 with image from Tsai et al., 2026
gut ccne1 expression increased amount, abnormal gon4lann2112/nn2112 standard conditions Fig. 4 with image from Tsai et al., 2026
intestine lumen nucleus condensed, abnormal gon4lann2112/nn2112 standard conditions Fig. 4 with image from Tsai et al., 2026
whole organism decreased mass, abnormal gon4lann2112/nn2112 standard conditions Fig. 2 with image from Tsai et al., 2026
whole organism viability, abnormal gon4lann2112/nn2112 standard conditions Fig. 2 with image from Tsai et al., 2026
vertebra shortened, abnormal gon4lann2112/nn2112 standard conditions Fig. 3 with image from Tsai et al., 2026
exocrine pancreas zymogen granule exocytosis decreased occurrence, abnormal gon4lann2112/nn2112 standard conditions Fig. 5 with image from Tsai et al., 2026
gut wee1 expression increased amount, abnormal gon4lann2112/nn2112 standard conditions Fig. 4 with image from Tsai et al., 2026
gut ccnd1 expression increased amount, abnormal gon4lann2112/nn2112 standard conditions Fig. 4 with image from Tsai et al., 2026
head decreased size, abnormal gon4lann2112/nn2112 standard conditions Fig. 2 with image from Tsai et al., 2026
metapterygoid decreased size, abnormal gon4lann2112/nn2112 standard conditions Fig. 2 with image from Tsai et al., 2026
whole organism decreased size, abnormal gon4lann2112/nn2112 standard conditions Fig. 2 with image from Tsai et al., 2026
liver ghra expression increased amount, abnormal gon4lann2112/nn2112 standard conditions Fig. 3 with image from Tsai et al., 2026
liver igf1 expression decreased amount, abnormal gon4lann2112/nn2112 standard conditions Fig. 3 with image from Tsai et al., 2026
intestinal epithelium protein O-linked glycosylation via N-acetylgalactosamine decreased occurrence, abnormal gon4lann2112/nn2112 standard conditions Fig. 5 with image from Tsai et al., 2026
gut ccnb2 expression increased amount, abnormal gon4lann2112/nn2112 standard conditions Fig. 4 with image from Tsai et al., 2026
gut cdk1 expression increased amount, abnormal gon4lann2112/nn2112 standard conditions Fig. 4 with image from Tsai et al., 2026
vertebra bone tissue decreased mass density, abnormal gon4lann2112/nn2112 standard conditions Fig. 3 with image from Tsai et al., 2026
gut ccnd2b expression increased amount, abnormal gon4lann2112/nn2112 standard conditions Fig. 4 with image from Tsai et al., 2026
enteroendocrine cell circular, abnormal gon4lann2112/nn2112 standard conditions Fig. 5 with image from Tsai et al., 2026
caudal fin bone tissue shortened, abnormal gon4lann2112/nn2112 standard conditions Fig. 3 with image from Tsai et al., 2026
ceratohyal cartilage misaligned with palatoquadrate cartilage, abnormal gon4lann2112/nn2112 standard conditions Fig. 2 with image from Tsai et al., 2026
intestine lumen decreased size, abnormal gon4lann2112/nn2112 standard conditions Fig. 4 with image from Tsai et al., 2026
gut ccnd3 expression increased amount, abnormal gon4lann2112/nn2112 standard conditions Fig. 4 with image from Tsai et al., 2026
gut ccne2 expression increased amount, abnormal gon4lann2112/nn2112 standard conditions Fig. 4 with image from Tsai et al., 2026
gut prmt1 expression increased amount, abnormal gon4lann2112/nn2112 standard conditions Fig. 4 with image from Tsai et al., 2026
gut ccnb1 expression increased amount, abnormal gon4lann2112/nn2112 standard conditions Fig. 4 with image from Tsai et al., 2026
opercle decreased size, abnormal gon4lann2112/nn2112 standard conditions Fig. 2 with image from Tsai et al., 2026
liver gh1 expression increased amount, abnormal gon4lann2112/nn2112 standard conditions Fig. 3 with image from Tsai et al., 2026
gut ccnd2a expression increased amount, abnormal gon4lann2112/nn2112 standard conditions Fig. 4 with image from Tsai et al., 2026
Citations