CRISPR

CRISPR5-col4a1

ID
ZDB-CRISPR-251124-4
Name
CRISPR5-col4a1
Previous Names
None
Target
Sequence
5' - GAACCAGGTATAGGTCGGCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR5-col4a1
No data available
Phenotype
Phenotype resulting from CRISPR5-col4a1
No data available
Phenotype of all Fish created by or utilizing CRISPR5-col4a1
Phenotype Fish Conditions Figures
eye col4a1 expression decreased amount, abnormal WT + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 control Fig. 1 with image from Flatman et al., 2025
post-vent region col4a1 expression decreased amount, abnormal WT + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 control Fig. 1 with image from Flatman et al., 2025
brain hemorrhagic, abnormal WT + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 control Fig. 1 with image from Flatman et al., 2025
whole organism mmp9 expression increased amount, abnormal WT + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 control Fig. 4 with image from Flatman et al., 2025
whole organism col4a1 expression decreased amount, abnormal WT + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 control Fig. 1 with image from Flatman et al., 2025
head col4a1 expression decreased amount, abnormal WT + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 control Fig. 1 with image from Flatman et al., 2025
mid cerebral vein absence of anatomical entity, abnormal s843Tg + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 control Fig. 2 with image from Flatman et al., 2025
brain hemorrhagic, abnormal s843Tg + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 control Fig. 3 with image from Flatman et al., 2025
basilar artery increased width, abnormal s843Tg + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 control Fig. 3 with imageFig. 4 with image from Flatman et al., 2025
basilar artery width, ameliorated s843Tg + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 chemical treatment by environment: MMP9 inhibitor I Fig. 4 with image from Flatman et al., 2025
forebrain vasculature amount, ameliorated s843Tg + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 chemical treatment by environment: MMP9 inhibitor I Fig. 4 with image from Flatman et al., 2025
primordial hindbrain channel width, ameliorated s843Tg + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 chemical treatment by environment: MMP9 inhibitor I Fig. 4 with image from Flatman et al., 2025
brain vasculature kinked, abnormal s843Tg + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 control Fig. 2 with image from Flatman et al., 2025
primordial hindbrain channel increased width, abnormal s843Tg + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 control Fig. 3 with imageFig. 4 with image from Flatman et al., 2025
brain structure, ameliorated s843Tg + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 chemical treatment by environment: MMP9 inhibitor I Fig. 4 with image from Flatman et al., 2025
nasal vein absence of anatomical entity, abnormal s843Tg + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 control Fig. 2 with image from Flatman et al., 2025
primordial midbrain channel decreased distance primordial midbrain channel, abnormal s843Tg + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 control Fig. 3 with image from Flatman et al., 2025
brain vasculature structure, abnormal s843Tg + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 control Fig. 2 with image from Flatman et al., 2025
brain vasculature EGFP expression spatial pattern, abnormal s843Tg + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 control Fig. 2 with imageFig. 3 with image from Flatman et al., 2025
forebrain vasculature absence of anatomical entity, abnormal s843Tg + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 control Fig. 2 with imageFig. 3 with imageFig. 4 with image from Flatman et al., 2025
dorsal ciliary vein absence of anatomical entity, abnormal s843Tg + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 control Fig. 2 with image from Flatman et al., 2025
brain vasculature increased thickness, abnormal s843Tg + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 control Fig. 2 with image from Flatman et al., 2025
brain hemorrhagic, abnormal sd2Tg; y1Tg + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 control Fig. 1 with image from Flatman et al., 2025
brain nucleate erythrocyte DsRed expression spatial pattern, abnormal sd2Tg; y1Tg + CRISPR4-col4a1 + CRISPR5-col4a1 + CRISPR6-col4a1 + CRISPR7-col4a1 control Fig. 1 with image from Flatman et al., 2025
Citations