CRISPR

CRISPR1-fcsk

ID

ZDB-CRISPR-250630-1

Name

CRISPR1-fcsk

Previous Names

None

Target

fcsk (1)

Sequence

5' - ACCCCAGAAAACCCGTCCCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "TGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
hzu301	fcsk

Expression

Gene expression in Wild Types + CRISPR1-fcsk

No data available

Phenotype

Phenotype resulting from CRISPR1-fcsk

No data available

Phenotype of all Fish created by or utilizing CRISPR1-fcsk

Phenotype	Fish	Conditions	Figures
swimming behavior increased process quality, abnormal	fcsk^{hzu301/hzu301} (AB)	chemical treatment by environment: pentetrazol	Fig. 3 from Liu et al., 2025
swimming behavior decreased process quality, abnormal	fcsk^{hzu301/hzu301} (AB)	lighting conditions	Fig. 3 from Liu et al., 2025
behavioral fear response increased process quality, abnormal	fcsk^{hzu301/hzu301} (AB)	control	Fig. 4 from Liu et al., 2025
whole organism fus expression decreased amount, abnormal	fcsk^{hzu301/hzu301} (AB)	standard conditions	Fig. 7 from Liu et al., 2025
learning or memory decreased process quality, abnormal	fcsk^{hzu301/hzu301} (AB)	control	Fig. 4 from Liu et al., 2025
whole organism capn2l expression decreased amount, abnormal	fcsk^{hzu301/hzu301} (AB)	standard conditions	Fig. 7 from Liu et al., 2025
whole organism fcsk expression decreased amount, abnormal	fcsk^{hzu301/hzu301} (AB)	standard conditions	Fig. 1 from Liu et al., 2025
brain decreased weight, abnormal	fcsk^{hzu301/hzu301} (AB)	standard conditions	Fig. 2 from Liu et al., 2025
whole organism st8sia7.1 expression decreased amount, abnormal	fcsk^{hzu301/hzu301} (AB)	standard conditions	Fig. 7 from Liu et al., 2025
social behavior decreased process quality, abnormal	fcsk^{hzu301/hzu301} (AB)	control	Fig. 4 from Liu et al., 2025
whole organism st8sia6 expression decreased amount, abnormal	fcsk^{hzu301/hzu301} (AB)	standard conditions	Fig. 7 from Liu et al., 2025
whole organism protein O-linked fucosylation decreased process quality, abnormal	fcsk^{hzu301/hzu301} (AB)	standard conditions	Fig. 5 , Fig. 6 from Liu et al., 2025
whole organism akt2l expression decreased amount, abnormal	fcsk^{hzu301/hzu301} (AB)	standard conditions	Fig. 7 from Liu et al., 2025
whole organism pik3r3b expression decreased amount, abnormal	fcsk^{hzu301/hzu301} (AB)	standard conditions	Fig. 7 from Liu et al., 2025
whole organism gadd45ga expression decreased amount, abnormal	fcsk^{hzu301/hzu301} (AB)	standard conditions	Fig. 7 from Liu et al., 2025
whole organism decreased length, abnormal	fcsk^{hzu301/hzu301} (AB)	standard conditions	Fig. 2 , Fig. 6 from Liu et al., 2025
whole organism protein O-linked fucosylation process quality, ameliorated	fcsk^{hzu301/hzu301} (AB)	chemical treatment by injection: GDP-L-fucose	Fig. 6 from Liu et al., 2025
whole organism deoxyribonucleic acid decreased amount, abnormal	fcsk^{hzu301/hzu301} (AB)	standard conditions	Fig. 2 from Liu et al., 2025
epiboly delayed, abnormal	fcsk^{hzu301/hzu301} (AB)	standard conditions	Fig. 2 from Liu et al., 2025
aggressive behavior decreased process quality, abnormal	fcsk^{hzu301/hzu301} (AB)	control	Fig. 4 from Liu et al., 2025
whole organism zgc:162184 expression increased amount, abnormal	fcsk^{hzu301/hzu301} (AB)	standard conditions	Fig. 7 from Liu et al., 2025
whole organism pofut2 expression decreased amount, abnormal	fcsk^{hzu301/hzu301} (AB)	standard conditions	Fig. 5 from Liu et al., 2025
whole organism length, ameliorated	fcsk^{hzu301/hzu301} (AB)	chemical treatment by injection: GDP-L-fucose	Fig. 6 from Liu et al., 2025
whole organism capn2l expression increased amount, abnormal	fcsk^{hzu301/hzu301} (AB)	standard conditions	Fig. 7 from Liu et al., 2025
whole organism pmaip1 expression increased amount, abnormal	fcsk^{hzu301/hzu301} (AB)	standard conditions	Fig. 7 from Liu et al., 2025
midbrain hindbrain boundary apoptotic process increased process quality, abnormal	fcsk^{hzu301/hzu301} (AB)	standard conditions	Fig. 5 from Liu et al., 2025
swimming behavior decreased process quality, abnormal	fcsk^{hzu301/hzu301} (AB)	lighting conditions	Fig. 3 from Liu et al., 2025

Citations