CRISPR

CRISPR5-il6

ID

ZDB-CRISPR-241007-1

Name

CRISPR5-il6

Previous Names

None

Target

il6 (1)

Sequence

5' - GGCAGCGGTCTGAAGGTTTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf4118	il6

Expression

Gene expression in Wild Types + CRISPR5-il6

No data available

Phenotype

Phenotype resulting from CRISPR5-il6

No data available

Phenotype of all Fish created by or utilizing CRISPR5-il6

Phenotype	Fish	Conditions	Figures
liver tmco1 expression increased amount, abnormal	il6^{zf4118/zf4118} (AB)	bacterial treatment by injection: Aeromonas hydrophila	Figure 3 from Zhai et al., 2023
liver ctnnb2 expression decreased amount, abnormal	il6^{zf4118/zf4118} (AB)	bacterial treatment by injection: Aeromonas hydrophila	Figure 3 from Zhai et al., 2023
liver apoeb expression decreased amount, abnormal	il6^{zf4118/zf4118} (AB)	bacterial treatment by injection: Aeromonas hydrophila	Figure 3 from Zhai et al., 2023
liver malonaldehyde amount, ameliorated	il6^{zf4118/zf4118} (AB)	bacterial treatment by injection: Aeromonas hydrophila	Figure 5 from Zhai et al., 2023
liver dpm3 expression increased amount, abnormal	il6^{zf4118/zf4118} (AB)	bacterial treatment by injection: Aeromonas hydrophila	Figure 3 from Zhai et al., 2023
liver aldh1l1 expression decreased amount, abnormal	il6^{zf4118/zf4118} (AB)	bacterial treatment by injection: Aeromonas hydrophila	Figure 3 from Zhai et al., 2023
liver L-alanine:2-oxoglutarate aminotransferase activity process quality, ameliorated	il6^{zf4118/zf4118} (AB)	bacterial treatment by injection: Aeromonas hydrophila	Figure 2 , Figure 7 from Zhai et al., 2023
liver aclya expression increased amount, abnormal	il6^{zf4118/zf4118} (AB)	bacterial treatment by injection: Aeromonas hydrophila	Figure 3 from Zhai et al., 2023
liver L-aspartate:2-oxoglutarate aminotransferase activity process quality, ameliorated	il6^{zf4118/zf4118} (AB)	bacterial treatment by injection: Aeromonas hydrophila	Figure 2 , Figure 7 from Zhai et al., 2023
liver damage, ameliorated	il6^{zf4118/zf4118} (AB)	bacterial treatment by injection: Aeromonas hydrophila	Figure 2 from Zhai et al., 2023
liver lrpap1 expression increased amount, abnormal	il6^{zf4118/zf4118} (AB)	bacterial treatment by injection: Aeromonas hydrophila	Figure 3 from Zhai et al., 2023
liver superoxide dismutase activity process quality, ameliorated	il6^{zf4118/zf4118} (AB)	bacterial treatment by injection: Aeromonas hydrophila	Figure 5 from Zhai et al., 2023
liver cyp51 expression increased amount, abnormal	il6^{zf4118/zf4118} (AB)	bacterial treatment by injection: Aeromonas hydrophila	Figure 3 from Zhai et al., 2023
liver dazap2 expression decreased amount, abnormal	il6^{zf4118/zf4118} (AB)	bacterial treatment by injection: Aeromonas hydrophila	Figure 3 from Zhai et al., 2023
liver abcc2 expression decreased amount, abnormal	il6^{zf4118/zf4118} (AB)	bacterial treatment by injection: Aeromonas hydrophila	Figure 3 from Zhai et al., 2023
liver reactive oxygen species amount, ameliorated	il6^{zf4118/zf4118} (AB)	bacterial treatment by injection: Aeromonas hydrophila	Figure 5 from Zhai et al., 2023
liver nucleate erythrocyte infiltrative, abnormal	il6^{zf4118/zf4118} (AB)	bacterial treatment by injection: Aeromonas hydrophila	Figure 2 from Zhai et al., 2023

Citations