CRISPR

CRISPR1-stx18

ID
ZDB-CRISPR-240920-1
Name
CRISPR1-stx18
Previous Names
None
Target
Sequence
5' - GGACCATCGAGCAGCAGTGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-stx18
No data available
Phenotype
Phenotype resulting from CRISPR1-stx18
Phenotype Fish Figures
bone mineralization delayed, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
ceratobranchial 1 cartilage disorganized, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
ceratobranchial 2 cartilage disorganized, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
ceratobranchial 3 cartilage disorganized, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
ceratobranchial 4 cartilage disorganized, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
ceratobranchial 5 bone perichondral ossification decreased process quality, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
ceratobranchial 5 cartilage disorganized, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
ceratohyal cartilage deformed, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
chondrocyte disorganized, abnormal AB + CRISPR1-stx18 Fig. 4 with image from Guillemyn et al., 2023
chondrocyte morphology, abnormal AB + CRISPR1-stx18 Fig. 4 with image from Guillemyn et al., 2023
chondrocyte endoplasmic reticulum cisternal network increased size, abnormal AB + CRISPR1-stx18 Fig. 4 with image from Guillemyn et al., 2023
cleithrum intramembranous ossification decreased process quality, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
entopterygoid absence of anatomical entity, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
ethmoid cartilage decreased size, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
eye protruding, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
head decreased size, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
hyomandibula perichondral ossification decreased process quality, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
intramembranous ossification delayed, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
Meckel's cartilage deformed, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
notochord curved, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
notochord increased curvature, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
notochord outer sheath cell biomineral tissue development delayed, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
opercle intramembranous ossification decreased process quality, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
ossification delayed, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
parasphenoid intramembranous ossification decreased process quality, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
pectoral fin bent, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
pectoral fin decreased size, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
pectoral fin kinked, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
pectoral fin malformed, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
perichondral ossification delayed, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
splanchnocranium hypoplastic, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
swim bladder hypoplastic, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
swim bladder uninflated, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
ventral mandibular arch malformed, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
whole organism dead, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
whole organism sp7 expression decreased amount, abnormal AB + CRISPR1-stx18 Fig. 3 with image from Guillemyn et al., 2023
whole organism col10a1a expression decreased amount, abnormal AB + CRISPR1-stx18 Fig. 3 with image from Guillemyn et al., 2023
whole organism col2a1a expression decreased amount, abnormal AB + CRISPR1-stx18 Fig. 3 with image from Guillemyn et al., 2023
whole organism col2a1b expression decreased amount, abnormal AB + CRISPR1-stx18 Fig. 3 with image from Guillemyn et al., 2023
whole organism decreased life span, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
whole organism decreased size, abnormal AB + CRISPR1-stx18 Fig. 2 with image from Guillemyn et al., 2023
whole organism sec23a expression increased amount, abnormal AB + CRISPR1-stx18 Fig. 5 with image from Guillemyn et al., 2023
whole organism bnip1b expression increased amount, abnormal AB + CRISPR1-stx18 Fig. 5 with image from Guillemyn et al., 2023
whole organism scfd1 expression increased amount, abnormal AB + CRISPR1-stx18 Fig. 5 with image from Guillemyn et al., 2023
whole organism bnip1a expression increased amount, abnormal AB + CRISPR1-stx18 Fig. 5 with image from Guillemyn et al., 2023
whole organism copa expression increased amount, abnormal AB + CRISPR1-stx18 Fig. 5 with image from Guillemyn et al., 2023
whole organism sec22bb expression increased amount, abnormal AB + CRISPR1-stx18 Fig. 5 with image from Guillemyn et al., 2023
whole organism sec22ba expression increased amount, abnormal AB + CRISPR1-stx18 Fig. 5 with image from Guillemyn et al., 2023
whole organism arf1 expression increased amount, abnormal AB + CRISPR1-stx18 Fig. 5 with image from Guillemyn et al., 2023
whole organism use1 expression increased amount, abnormal AB + CRISPR1-stx18 Fig. 5 with image from Guillemyn et al., 2023
whole organism rint1 expression increased amount, abnormal AB + CRISPR1-stx18 Fig. 5 with image from Guillemyn et al., 2023
whole organism mia3 expression increased amount, abnormal AB + CRISPR1-stx18 Fig. 5 with image from Guillemyn et al., 2023
whole organism zw10 expression increased amount, abnormal AB + CRISPR1-stx18 Fig. 5 with image from Guillemyn et al., 2023
whole organism kdelr2a expression increased amount, abnormal AB + CRISPR1-stx18 Fig. 5 with image from Guillemyn et al., 2023
whole organism sec24d expression increased amount, abnormal AB + CRISPR1-stx18 Fig. 5 with image from Guillemyn et al., 2023
Phenotype of all Fish created by or utilizing CRISPR1-stx18
Phenotype Fish Conditions Figures
bone mineralization delayed, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
ceratobranchial 4 cartilage disorganized, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
whole organism decreased size, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
entopterygoid absence of anatomical entity, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
Meckel's cartilage deformed, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
whole organism col2a1b expression decreased amount, abnormal AB + CRISPR1-stx18 standard conditions Fig. 3 with image from Guillemyn et al., 2023
whole organism bnip1b expression increased amount, abnormal AB + CRISPR1-stx18 standard conditions Fig. 5 with image from Guillemyn et al., 2023
whole organism scfd1 expression increased amount, abnormal AB + CRISPR1-stx18 standard conditions Fig. 5 with image from Guillemyn et al., 2023
ceratobranchial 5 cartilage disorganized, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
pectoral fin bent, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
whole organism decreased life span, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
ventral mandibular arch malformed, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
whole organism sp7 expression decreased amount, abnormal AB + CRISPR1-stx18 standard conditions Fig. 3 with image from Guillemyn et al., 2023
whole organism zw10 expression increased amount, abnormal AB + CRISPR1-stx18 standard conditions Fig. 5 with image from Guillemyn et al., 2023
chondrocyte endoplasmic reticulum cisternal network increased size, abnormal AB + CRISPR1-stx18 standard conditions Fig. 4 with image from Guillemyn et al., 2023
whole organism col10a1a expression decreased amount, abnormal AB + CRISPR1-stx18 standard conditions Fig. 3 with image from Guillemyn et al., 2023
ceratobranchial 1 cartilage disorganized, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
pectoral fin decreased size, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
ceratohyal cartilage deformed, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
ethmoid cartilage decreased size, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
pectoral fin kinked, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
ceratobranchial 2 cartilage disorganized, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
whole organism sec22bb expression increased amount, abnormal AB + CRISPR1-stx18 standard conditions Fig. 5 with image from Guillemyn et al., 2023
eye protruding, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
notochord outer sheath cell biomineral tissue development delayed, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
ceratobranchial 3 cartilage disorganized, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
hyomandibula perichondral ossification decreased process quality, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
whole organism dead, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
opercle intramembranous ossification decreased process quality, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
cleithrum intramembranous ossification decreased process quality, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
parasphenoid intramembranous ossification decreased process quality, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
notochord increased curvature, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
chondrocyte morphology, abnormal AB + CRISPR1-stx18 standard conditions Fig. 4 with image from Guillemyn et al., 2023
whole organism kdelr2a expression increased amount, abnormal AB + CRISPR1-stx18 standard conditions Fig. 5 with image from Guillemyn et al., 2023
notochord curved, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
perichondral ossification delayed, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
splanchnocranium hypoplastic, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
ossification delayed, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
whole organism sec23a expression increased amount, abnormal AB + CRISPR1-stx18 standard conditions Fig. 5 with image from Guillemyn et al., 2023
intramembranous ossification delayed, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
whole organism sec24d expression increased amount, abnormal AB + CRISPR1-stx18 standard conditions Fig. 5 with image from Guillemyn et al., 2023
whole organism sec22ba expression increased amount, abnormal AB + CRISPR1-stx18 standard conditions Fig. 5 with image from Guillemyn et al., 2023
swim bladder uninflated, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
whole organism use1 expression increased amount, abnormal AB + CRISPR1-stx18 standard conditions Fig. 5 with image from Guillemyn et al., 2023
whole organism copa expression increased amount, abnormal AB + CRISPR1-stx18 standard conditions Fig. 5 with image from Guillemyn et al., 2023
whole organism rint1 expression increased amount, abnormal AB + CRISPR1-stx18 standard conditions Fig. 5 with image from Guillemyn et al., 2023
pectoral fin malformed, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
whole organism mia3 expression increased amount, abnormal AB + CRISPR1-stx18 standard conditions Fig. 5 with image from Guillemyn et al., 2023
swim bladder hypoplastic, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
whole organism arf1 expression increased amount, abnormal AB + CRISPR1-stx18 standard conditions Fig. 5 with image from Guillemyn et al., 2023
head decreased size, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
whole organism col2a1a expression decreased amount, abnormal AB + CRISPR1-stx18 standard conditions Fig. 3 with image from Guillemyn et al., 2023
whole organism bnip1a expression increased amount, abnormal AB + CRISPR1-stx18 standard conditions Fig. 5 with image from Guillemyn et al., 2023
ceratobranchial 5 bone perichondral ossification decreased process quality, abnormal AB + CRISPR1-stx18 standard conditions Fig. 2 with image from Guillemyn et al., 2023
chondrocyte disorganized, abnormal AB + CRISPR1-stx18 standard conditions Fig. 4 with image from Guillemyn et al., 2023
Citations