CRISPR

CRISPR4-dspb

ID
ZDB-CRISPR-240301-12
Name
CRISPR4-dspb
Previous Names
None
Target
Sequence
5' - GGAAGTGCATCTCCAGACTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ia303 dspb
Expression
Gene expression in Wild Types + CRISPR4-dspb
No data available
Phenotype
Phenotype resulting from CRISPR4-dspb
No data available
Phenotype of all Fish created by or utilizing CRISPR4-dspb
Phenotype Fish Conditions Figures
heart dilated, abnormal dspbia303/ia303 standard conditions Fig. 1 with image from Celeghin et al., 2023
blastema cell population proliferation decreased process quality, abnormal AB + CRISPR3-dspa + CRISPR3-dspb + CRISPR4-dspa + CRISPR4-dspb + CRISPR5-dspa + CRISPR5-dspb amputation: ventral fin fold Fig. S11 from Ha et al., 2022
fin regeneration decreased process quality, abnormal AB + CRISPR3-dspa + CRISPR3-dspb + CRISPR4-dspa + CRISPR4-dspb + CRISPR5-dspa + CRISPR5-dspb amputation: ventral fin fold Fig. S11 from Ha et al., 2022
heart Ab8-lcp1 labeling increased amount, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 2 with image from Celeghin et al., 2023
heart accumulation fat cell, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 6 with image from Celeghin et al., 2023
heart smad2 expression decreased amount, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 4 with image from Celeghin et al., 2023
heart ccn2b expression decreased amount, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 4 with image from Celeghin et al., 2023
heart mycbp expression decreased amount, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 4 with image from Celeghin et al., 2023
myocardium accumulation fat cell, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 6 with image from Celeghin et al., 2023
whole organism decreased length, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 1 with image from Celeghin et al., 2023
whole organism life span, ameliorated dspasa13356/+; dspbia303/+ chemical treatment by environment: Wnt signalling activator Fig. 7 with image from Celeghin et al., 2023
leukocyte increased amount, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 2 with image from Celeghin et al., 2023
whole organism decreased life span, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 7 with image from Celeghin et al., 2023
heart blood vessel dilated, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 6 with image from Celeghin et al., 2023
heart desmosome disorganized, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 5 with image from Celeghin et al., 2023
heart desmosome low saturation, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 5 with image from Celeghin et al., 2023
eye decreased size, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 1 with image from Celeghin et al., 2023
trabecular layer disorganized, exacerbated dspasa13356/+; dspbia303/+ water flow Fig. 6 with image from Celeghin et al., 2023
heart blood vessel dilated, exacerbated dspasa13356/+; dspbia303/+ water flow Fig. 6 with image from Celeghin et al., 2023
cardiac ventricle shape, exacerbated dspasa13356/+; dspbia303/+ water flow Fig. 6 with image from Celeghin et al., 2023
whole organism decreased life span, exacerbated dspasa13356/+; dspbia303/+ chemical treatment by environment: methyl cellulose Fig. 7 with image from Celeghin et al., 2023
heart ccnd1 expression decreased amount, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 4 with image from Celeghin et al., 2023
heart accumulation fat cell, exacerbated dspasa13356/+; dspbia303/+ water flow Fig. 6 with image from Celeghin et al., 2023
heart dilated, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 1 with image from Celeghin et al., 2023
cardiac ventricle dilated, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 5 with image from Celeghin et al., 2023
myocardium accumulation fat cell, exacerbated dspasa13356/+; dspbia303/+ water flow Fig. 6 with image from Celeghin et al., 2023
whole organism decreased life span, abnormal dspasa13356/+; dspbia303/+ chemical treatment by environment: methyl cellulose Fig. 3 with image from Celeghin et al., 2023
whole organism decreased life span, ameliorated dspasa13356/+; dspbia303/+ chemical treatment by environment: methyl cellulose, chemical treatment by environment: Wnt signalling activator Fig. 7 with image from Celeghin et al., 2023
myocardium thickness, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 6 with image from Celeghin et al., 2023
whole organism locomotory behavior decreased duration, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 3 with image from Celeghin et al., 2023
heart ccn2a expression decreased amount, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 4 with image from Celeghin et al., 2023
heart obsolete extracellular space increased size, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 5 with image from Celeghin et al., 2023
trabecular layer disorganized, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 6 with image from Celeghin et al., 2023
heart smad3a expression decreased amount, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 4 with image from Celeghin et al., 2023
cardiac ventricle shape, abnormal dspasa13356/+; dspbia303/+ standard conditions Fig. 6 with image from Celeghin et al., 2023
heart morphology, exacerbated dspasa13356/+; dspbia303/+; ia4Tg chemical treatment by environment: XAV939 Fig. 7 with image from Celeghin et al., 2023
heart contraction decreased rate, abnormal dspasa13356/+; dspbia303/+; ia4Tg chemical treatment by environment: XAV939 Fig. 7 with image from Celeghin et al., 2023
heart contraction rate, ameliorated dspasa13356/+; dspbia303/+; ia4Tg chemical treatment by environment: Wnt signalling activator Fig. 7 with image from Celeghin et al., 2023
heart contraction decreased rate, abnormal dspasa13356/+; dspbia303/+; ia4Tg standard conditions Fig. 7 with image from Celeghin et al., 2023
heart morphology, abnormal dspasa13356/+; dspbia303/+; ia4Tg standard conditions Fig. 7 with image from Celeghin et al., 2023
heart morphology, ameliorated dspasa13356/+; dspbia303/+; ia4Tg chemical treatment by environment: Wnt signalling activator Fig. 7 with image from Celeghin et al., 2023
heart inflamed, abnormal dspasa13356/+; dspbia303/+; ia300Tg standard conditions Fig. 2 with image from Celeghin et al., 2023
heart dilated, abnormal dspasa13356/+; dspbia303/+; ia300Tg standard conditions Fig. 2 with image from Celeghin et al., 2023
heart dilated, abnormal dspasa13356/sa13356; dspbia303/ia303 standard conditions Fig. 1 with image from Celeghin et al., 2023
Citations