CRISPR
CRISPR4-casp3a
- ID
- ZDB-CRISPR-210407-3
- Name
- CRISPR4-casp3a
- Previous Names
- None
- Target
- Sequence
-
5' - GGATAATCTGCGCAACTGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The first two "G"s were added.
- Genome Resources
- None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR4-casp3a
No data available
Phenotype
Phenotype resulting from CRISPR4-casp3a
No data available
Phenotype of all Fish created by or utilizing CRISPR4-casp3a
1 - 5 of 5
Citations
- Zhang, L., Chen, C., Fu, J., Lilley, B., Berlinicke, C., Hansen, B., Ding, D., Wang, G., Wang, T., Shou, D., Ye, Y., Mulligan, T., Emmerich, K., Saxena, M.T., Hall, K.R., Sharrock, A.V., Brandon, C., Park, H., Kam, T.I., Dawson, V.L., Dawson, T.M., Shim, J.S., Hanes, J., Ji, H., Liu, J.O., Qian, J., Ackerley, D.F., Rohrer, B., Zack, D.J., Mumm, J.S. (2021) Large-scale phenotypic drug screen identifies neuroprotectants in zebrafish and mouse models of retinitis pigmentosa. eLIFE. 10:
- Wang, Z., Gu, Z., Hou, Q., Chen, W., Mu, D., Zhang, Y., Liu, Q., Liu, Z., Yang, D. (2020) Zebrafish GSDMEb Cleavage-Gated Pyroptosis Drives Septic-Acute Kidney Injury In Vivo. Journal of immunology (Baltimore, Md. : 1950). 204(7):1929-1942
1 - 2 of 2
Show