CRISPR

CRISPR1-npy

ID
ZDB-CRISPR-201118-2
Name
CRISPR1-npy
Previous Names
None
Target
Sequence
5' - TTCTCTTGTTCGTCTGCTTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "GGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
kgs1 npy
kgs2 npy
Expression
Gene expression in Wild Types + CRISPR1-npy
No data available
Phenotype
Phenotype resulting from CRISPR1-npy
No data available
Phenotype of all Fish created by or utilizing CRISPR1-npy
Phenotype Fish Conditions Figures
brain hcrt expression increased amount, abnormal npykgs1/kgs1 temperature shock Fig. 8 from Shiozaki et al., 2020
brain th expression increased amount, abnormal npykgs1/kgs1 temperature shock Fig. 8 from Shiozaki et al., 2020
brain th2 expression increased amount, abnormal npykgs1/kgs1 temperature shock Fig. 8 from Shiozaki et al., 2020
brain nr3c1 expression increased amount, abnormal npykgs1/kgs1 temperature shock Fig. 8 from Shiozaki et al., 2020
brain cckb expression increased amount, abnormal npykgs1/kgs1 temperature shock Fig. 8 from Shiozaki et al., 2020
behavioral fear response increased occurrence, abnormal npykgs1/kgs1 standard conditions Fig. 4 from Shiozaki et al., 2020
swimming behavior decreased linear velocity, abnormal npykgs1/kgs1 temperature shock Fig. 5 from Shiozaki et al., 2020
brain nr3c2 expression increased amount, abnormal npykgs1/kgs1 temperature shock Fig. 8 from Shiozaki et al., 2020
swimming behavior process quality, abnormal npykgs1/kgs1 temperature shock Fig. 5 from Shiozaki et al., 2020
behavioral fear response increased occurrence, abnormal npykgs1/kgs1 temperature shock Fig. 5 from Shiozaki et al., 2020
aggressive behavior decreased occurrence, abnormal npykgs1/kgs1 standard conditions Fig. 4 from Shiozaki et al., 2020
brain pomca expression increased amount, abnormal npykgs1/kgs1 standard conditions Fig. 7 from Shiozaki et al., 2020
brain avp expression increased amount, abnormal npykgs1/kgs1 standard conditions Fig. 7 from Shiozaki et al., 2020
aggressive behavior decreased occurrence, abnormal npykgs1/kgs1 temperature shock Fig. 5 from Shiozaki et al., 2020
brain th expression increased amount, abnormal npykgs2/kgs2 temperature shock Fig. 8 from Shiozaki et al., 2020
brain hcrt expression increased amount, abnormal npykgs2/kgs2 temperature shock Fig. 8 from Shiozaki et al., 2020
swimming behavior decreased process quality, abnormal npykgs2/kgs2 standard conditions Fig. 5 from Kawabe et al., 2021
brain th2 expression increased amount, abnormal npykgs2/kgs2 temperature shock Fig. 8 from Shiozaki et al., 2020
behavioral fear response increased occurrence, abnormal npykgs2/kgs2 standard conditions Fig. 4 from Shiozaki et al., 2020
swimming behavior decreased linear velocity, abnormal npykgs2/kgs2 temperature shock Fig. 5 from Shiozaki et al., 2020
brain cckb expression increased amount, abnormal npykgs2/kgs2 temperature shock Fig. 8 from Shiozaki et al., 2020
swimming behavior decreased process quality, ameliorated npykgs2/kgs2 chemical treatment by environment: Schizandrin Fig. 5 from Kawabe et al., 2021
brain nr3c2 expression increased amount, abnormal npykgs2/kgs2 temperature shock Fig. 8 from Shiozaki et al., 2020
brain th expression increased amount, abnormal npykgs2/kgs2 standard conditions Fig. 5 from Kawabe et al., 2021
swimming behavior process quality, abnormal npykgs2/kgs2 temperature shock Fig. 5 from Shiozaki et al., 2020
behavioral fear response increased occurrence, abnormal npykgs2/kgs2 temperature shock Fig. 5 from Shiozaki et al., 2020
brain nr3c1 expression increased amount, abnormal npykgs2/kgs2 temperature shock Fig. 8 from Shiozaki et al., 2020
aggressive behavior decreased occurrence, abnormal npykgs2/kgs2 standard conditions Fig. 4 from Shiozaki et al., 2020
brain pomca expression increased amount, abnormal npykgs2/kgs2 standard conditions Fig. 7 from Shiozaki et al., 2020
brain th expression amount, ameliorated npykgs2/kgs2 chemical treatment by environment: Schizandrin Fig. 5 from Kawabe et al., 2021
behavioral fear response onset quality, abnormal npykgs2/kgs2 standard conditions Fig. 1Fig. 5 from Kawabe et al., 2021
aggressive behavior decreased occurrence, abnormal npykgs2/kgs2 temperature shock Fig. 5 from Shiozaki et al., 2020
behavioral fear response onset quality, ameliorated npykgs2/kgs2 chemical treatment by environment: Schizandrin Fig. 5 from Kawabe et al., 2021
brain avp expression increased amount, abnormal npykgs2/kgs2 standard conditions Fig. 7 from Shiozaki et al., 2020
Citations