CRISPR

CRISPR2-scgn

ID
ZDB-CRISPR-200505-2
Name
CRISPR2-scgn
Previous Names
None
Target
Sequence
5' - CTACATTGAAGGGAAAGAGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3193 scgn
Expression
Gene expression in Wild Types + CRISPR2-scgn
No data available
Phenotype
Phenotype resulting from CRISPR2-scgn
No data available
Phenotype of all Fish created by or utilizing CRISPR2-scgn
Phenotype Fish Conditions Figures
blood plasma oxt expression decreased amount, abnormal scgnzf3193/zf3193 standard conditions Fig. 5 with image from Liu et al., 2023
social behavior decreased occurrence, abnormal scgnzf3193/zf3193 standard conditions Fig. 2 with imageFig. 6 with image from Liu et al., 2023
whole organism increased distance whole organism, abnormal scgnzf3193/zf3193 standard conditions Fig. 2 with image from Liu et al., 2023
whole organism il1b expression amount, ameliorated scgnzf3193/zf3193 chemical treatment by environment: carbetocin Fig. 6 with image from Liu et al., 2023
whole organism il6 expression increased amount, abnormal scgnzf3193/zf3193 standard conditions Fig. 5 with image from Liu et al., 2023
eye decreased distance eye, abnormal scgnzf3193/zf3193 standard conditions Fig. 3 with image from Liu et al., 2023
whole organism il1b expression increased amount, abnormal scgnzf3193/zf3193 standard conditions Fig. 5 with imageFig. 6 with image from Liu et al., 2023
head decreased size, abnormal scgnzf3193/zf3193 standard conditions Fig. 3 with image from Liu et al., 2023
brain oxt expression decreased amount, abnormal scgnzf3193/zf3193 standard conditions Fig. 5 with image from Liu et al., 2023
eye decreased size, abnormal scgnzf3193/zf3193 standard conditions Fig. 3 with image from Liu et al., 2023
social behavior occurrence, ameliorated scgnzf3193/zf3193 chemical treatment by environment: acetylsalicylic acid Fig. 6 with image from Liu et al., 2023
whole organism il1b expression amount, ameliorated scgnzf3193/zf3193 chemical treatment by environment: dexamethasone Fig. 6 with image from Liu et al., 2023
whole organism tnfa expression increased amount, abnormal scgnzf3193/zf3193 standard conditions Fig. 5 with image from Liu et al., 2023
whole organism oxt expression decreased amount, abnormal scgnzf3193/zf3193 standard conditions Fig. 5 with image from Liu et al., 2023
multicellular organism development delayed, abnormal scgnzf3193/zf3193 standard conditions Fig. 3 with image from Liu et al., 2023
whole organism lta expression increased amount, abnormal scgnzf3193/zf3193 standard conditions Fig. 5 with image from Liu et al., 2023
whole organism il1b expression amount, ameliorated scgnzf3193/zf3193 chemical treatment by environment: acetylsalicylic acid Fig. 6 with image from Liu et al., 2023
midbrain decreased size, abnormal scgnzf3193/zf3193 standard conditions Fig. 7 from Qin et al., 2020
social behavior occurrence, ameliorated scgnzf3193/zf3193 chemical treatment by environment: carbetocin Fig. 6 with image from Liu et al., 2023
whole organism increased distance whole organism, abnormal scgnzf3193/+ standard conditions Fig. 2 with image from Liu et al., 2023
social behavior decreased occurrence, abnormal scgnzf3193/+ standard conditions Fig. 2 with image from Liu et al., 2023
blood plasma oxt expression decreased amount, abnormal scgnzf3193/+ standard conditions Fig. 5 with image from Liu et al., 2023
head decreased size, abnormal scgnzf3193/+ standard conditions Fig. 3 with image from Liu et al., 2023
whole organism tnfa expression increased amount, abnormal scgnzf3193/+ standard conditions Fig. 5 with image from Liu et al., 2023
whole organism lta expression increased amount, abnormal scgnzf3193/+ standard conditions Fig. 5 with image from Liu et al., 2023
whole organism il6 expression increased amount, abnormal scgnzf3193/+ standard conditions Fig. 5 with image from Liu et al., 2023
whole organism il1b expression amount, ameliorated scgnzf3193/+ chemical treatment by environment: carbetocin Fig. 6 with image from Liu et al., 2023
whole organism il1b expression amount, ameliorated scgnzf3193/+ chemical treatment by environment: acetylsalicylic acid Fig. 6 with image from Liu et al., 2023
eye decreased size, abnormal scgnzf3193/+ standard conditions Fig. 3 with image from Liu et al., 2023
whole organism oxt expression decreased amount, abnormal scgnzf3193/+ standard conditions Fig. 5 with image from Liu et al., 2023
whole organism il1b expression amount, ameliorated scgnzf3193/+ chemical treatment by environment: dexamethasone Fig. 6 with image from Liu et al., 2023
brain oxt expression decreased amount, abnormal scgnzf3193/+ standard conditions Fig. 5 with image from Liu et al., 2023
multicellular organism development delayed, abnormal scgnzf3193/+ standard conditions Fig. 3 with image from Liu et al., 2023
whole organism il1b expression increased amount, abnormal scgnzf3193/+ standard conditions Fig. 6 with image from Liu et al., 2023
brain decreased size, abnormal scgnzf3193/+; knu3Tg standard conditions Fig. 3 with image from Liu et al., 2023
brain decreased size, abnormal scgnzf3193/zf3193; knu3Tg standard conditions Fig. 3 with image from Liu et al., 2023
Citations