CRISPR

CRISPR1-scgn

ID

ZDB-CRISPR-200505-1

Name

CRISPR1-scgn

Previous Names

None

Target

scgn (1)

Sequence

5' - AAACCCGGCAGCATCTAGGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3193	scgn

Expression

Gene expression in Wild Types + CRISPR1-scgn

No data available

Phenotype

Phenotype resulting from CRISPR1-scgn

No data available

Phenotype of all Fish created by or utilizing CRISPR1-scgn

Phenotype	Fish	Conditions	Figures
blood plasma oxt expression decreased amount, abnormal	scgn^{zf3193/zf3193}	standard conditions	Fig. 5 from Liu et al., 2023
social behavior decreased occurrence, abnormal	scgn^{zf3193/zf3193}	standard conditions	Fig. 2 , Fig. 6 from Liu et al., 2023
whole organism increased distance whole organism, abnormal	scgn^{zf3193/zf3193}	standard conditions	Fig. 2 from Liu et al., 2023
whole organism il1b expression amount, ameliorated	scgn^{zf3193/zf3193}	chemical treatment by environment: carbetocin	Fig. 6 from Liu et al., 2023
whole organism il6 expression increased amount, abnormal	scgn^{zf3193/zf3193}	standard conditions	Fig. 5 from Liu et al., 2023
eye decreased distance eye, abnormal	scgn^{zf3193/zf3193}	standard conditions	Fig. 3 from Liu et al., 2023
whole organism il1b expression increased amount, abnormal	scgn^{zf3193/zf3193}	standard conditions	Fig. 5 , Fig. 6 from Liu et al., 2023
head decreased size, abnormal	scgn^{zf3193/zf3193}	standard conditions	Fig. 3 from Liu et al., 2023
brain oxt expression decreased amount, abnormal	scgn^{zf3193/zf3193}	standard conditions	Fig. 5 from Liu et al., 2023
eye decreased size, abnormal	scgn^{zf3193/zf3193}	standard conditions	Fig. 3 from Liu et al., 2023
social behavior occurrence, ameliorated	scgn^{zf3193/zf3193}	chemical treatment by environment: acetylsalicylic acid	Fig. 6 from Liu et al., 2023
whole organism il1b expression amount, ameliorated	scgn^{zf3193/zf3193}	chemical treatment by environment: dexamethasone	Fig. 6 from Liu et al., 2023
whole organism tnfa expression increased amount, abnormal	scgn^{zf3193/zf3193}	standard conditions	Fig. 5 from Liu et al., 2023
whole organism oxt expression decreased amount, abnormal	scgn^{zf3193/zf3193}	standard conditions	Fig. 5 from Liu et al., 2023
multicellular organism development delayed, abnormal	scgn^{zf3193/zf3193}	standard conditions	Fig. 3 from Liu et al., 2023
whole organism lta expression increased amount, abnormal	scgn^{zf3193/zf3193}	standard conditions	Fig. 5 from Liu et al., 2023
whole organism il1b expression amount, ameliorated	scgn^{zf3193/zf3193}	chemical treatment by environment: acetylsalicylic acid	Fig. 6 from Liu et al., 2023
midbrain decreased size, abnormal	scgn^{zf3193/zf3193}	standard conditions	Fig. 7 from Qin et al., 2020
social behavior occurrence, ameliorated	scgn^{zf3193/zf3193}	chemical treatment by environment: carbetocin	Fig. 6 from Liu et al., 2023
whole organism increased distance whole organism, abnormal	scgn^zf3193/+	standard conditions	Fig. 2 from Liu et al., 2023
social behavior decreased occurrence, abnormal	scgn^zf3193/+	standard conditions	Fig. 2 from Liu et al., 2023
blood plasma oxt expression decreased amount, abnormal	scgn^zf3193/+	standard conditions	Fig. 5 from Liu et al., 2023
head decreased size, abnormal	scgn^zf3193/+	standard conditions	Fig. 3 from Liu et al., 2023
whole organism tnfa expression increased amount, abnormal	scgn^zf3193/+	standard conditions	Fig. 5 from Liu et al., 2023
whole organism lta expression increased amount, abnormal	scgn^zf3193/+	standard conditions	Fig. 5 from Liu et al., 2023
whole organism il6 expression increased amount, abnormal	scgn^zf3193/+	standard conditions	Fig. 5 from Liu et al., 2023
whole organism il1b expression amount, ameliorated	scgn^zf3193/+	chemical treatment by environment: carbetocin	Fig. 6 from Liu et al., 2023
whole organism il1b expression amount, ameliorated	scgn^zf3193/+	chemical treatment by environment: acetylsalicylic acid	Fig. 6 from Liu et al., 2023
eye decreased size, abnormal	scgn^zf3193/+	standard conditions	Fig. 3 from Liu et al., 2023
whole organism oxt expression decreased amount, abnormal	scgn^zf3193/+	standard conditions	Fig. 5 from Liu et al., 2023
whole organism il1b expression amount, ameliorated	scgn^zf3193/+	chemical treatment by environment: dexamethasone	Fig. 6 from Liu et al., 2023
brain oxt expression decreased amount, abnormal	scgn^zf3193/+	standard conditions	Fig. 5 from Liu et al., 2023
multicellular organism development delayed, abnormal	scgn^zf3193/+	standard conditions	Fig. 3 from Liu et al., 2023
whole organism il1b expression increased amount, abnormal	scgn^zf3193/+	standard conditions	Fig. 6 from Liu et al., 2023
brain decreased size, abnormal	scgn^zf3193/+; knu3Tg	standard conditions	Fig. 3 from Liu et al., 2023
brain decreased size, abnormal	scgn^{zf3193/zf3193}; knu3Tg	standard conditions	Fig. 3 from Liu et al., 2023

Citations