CRISPR

CRISPR1-mipb

ID
ZDB-CRISPR-181017-5
Name
CRISPR1-mipb
Previous Names
None
Target
Sequence
5' - GGGGGCCATGGCAGGAGCCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ir1091 mipb
Expression
Gene expression in Wild Types + CRISPR1-mipb
No data available
Phenotype
Phenotype resulting from CRISPR1-mipb
No data available
Phenotype of all Fish created by or utilizing CRISPR1-mipb
Phenotype Fish Conditions Figures
lens fiber cell mipb expression absent, abnormal mipbir1091/ir1091 (AB) standard conditions Fig. 1 with imageFig. 5 with image from Vorontsova et al., 2018
lens central region refractivity, abnormal mipbir1091/ir1091 (AB) standard conditions Fig. 2 with image from Vorontsova et al., 2018
lens opacity, abnormal mipbir1091/ir1091 (AB) standard conditions Fig. 8 with image from Wang et al., 2021
lens lens development in camera-type eye decreased process quality, abnormal mipbir1091/ir1091 (AB) standard conditions Fig. 2 with image from Vorontsova et al., 2018
lens central region opaque, abnormal mipbir1091/ir1091 (AB) standard conditions Fig. 2 with image from Vorontsova et al., 2018
lens decreased diameter, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 1 with image from Wang et al., 2021
lens central region refractivity, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 2 with image from Vorontsova et al., 2018
lens anterior region opaque, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 3 with image from Vorontsova et al., 2018
lens fiber cell lens fiber cell morphogenesis decreased process quality, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 7 with image from Vorontsova et al., 2018
lens lens morphogenesis in camera-type eye decreased process quality, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 6 with image from Vorontsova et al., 2018
lens opaque, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 3 with image from Vorontsova et al., 2018
lens opacity, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 9 with imageFig. 10 with image from Wang et al., 2021
lens refractivity, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 1 with image from Safrina et al., 2024
Fig. 4 with imageFig. 5 with image from Wang et al., 2021
Fig. 4 with image from Vorontsova et al., 2018
lens lens development in camera-type eye decreased process quality, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 1 with image from Safrina et al., 2024
Fig. 2 with imageFig. 3 with imageFig. 4 with image from Vorontsova et al., 2018
lens central region opaque, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 1 with image from Safrina et al., 2024
Fig. 2 with imageFig. 4 with image from Vorontsova et al., 2018
lens malformed, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 1 with image from Safrina et al., 2024
Fig. 6 with image from Vorontsova et al., 2018
lens opacity, ameliorated mipair1090/ir1090; mipbir1091/ir1091; zf3920Tg (AB) standard conditions Fig. 1 with image from Safrina et al., 2024
lens refractivity, ameliorated mipair1090/ir1090; mipbir1091/ir1091; zf3920Tg (AB) standard conditions Fig. 1 with image from Safrina et al., 2024
lens morphology, ameliorated mipair1090/ir1090; mipbir1091/ir1091; zf3920Tg (AB) standard conditions Fig. 1 with image from Safrina et al., 2024
Citations