CRISPR
CRISPR1-camk2g1
- ID
- ZDB-CRISPR-140811-9
- Name
- CRISPR1-camk2g1
- Previous Names
- Target
- Sequence
-
5' - GGGGTGCCTTCTCCGTGGTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-camk2g1
No data available
Phenotype
Phenotype resulting from CRISPR1-camk2g1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-camk2g1
1 - 5 of 11 Show all
Citations
- Rothschild, S.C., Ingram, S.R., Lu, F.I., Thisse, B., Thisse, C., Parkerson, J.A., Tombes, R.M. (2020) Genetic compensation of γ CaMKII, an evolutionarily conserved gene. Gene. 742:144567
- Burger, A., Lindsay, H., Felker, A., Hess, C., Anders, C., Chiavacci, E., Zaugg, J., Weber, L.M., Catena, R., Jinek, M., Robinson, M.D., Mosimann, C. (2016) Maximizing mutagenesis with solubilized CRISPR-Cas9 ribonucleoprotein complexes. Development (Cambridge, England). 143(11):2025-37
- Thyme, S.B., Schier, A.F. (2016) Polq-Mediated End Joining Is Essential for Surviving DNA Double-Strand Breaks during Early Zebrafish Development. Cell Reports. 15(4):707-714
- Gagnon, J.A., Valen, E., Thyme, S.B., Huang, P., Ahkmetova, L., Pauli, A., Montague, T.G., Zimmerman, S., Richter, C., Schier, A.F. (2014) Efficient Mutagenesis by Cas9 Protein-Mediated Oligonucleotide Insertion and Large-Scale Assessment of Single-Guide RNAs. PLoS One. 9:e98186
1 - 4 of 4
Show